Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr7

Orthogroup ID

OG0007168

Physical Location & Seq

Genomic Coordinates Forward (+)

27298829 .. 27299820

Gene Structure 992 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom07g27680.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 540 bp

ATGGATAGGTATTTGTTGGTAAGGAATCATGATACTACTCAAGCAAGTTCCAGTGGACTTGAAAATTCGGGAGGTTCTAATATCCAGCTTGGTGACTCTATGGGTAGCACAAGTGATGAGATTTCGGGAAATAAGTTTACAAGGAAAAACAACGGTCGTCAGGTTCTCATTGATTGGATCTGGAACTACTTTTCTGACAATAATTTTACCAAATCTGGAAATCATCAGGTCATTGTCAGTGACAAAACACCCTTGTACTTCCAACATGATGGACATTCGAGAACGATTGTTGGGATTCAAGTCAAGCGTCAACATAATGGGATGCTCCAGCACAATCTCTTAATATTAGACCCTGGCCATAGAACGGAAGATCTGGAAAGATCGCTTAGAGAAAAGGCAGGATGGCAGAAGTTTGTAAAAAGAGGGGTTCACACGCTGAAAAAGCCACAGTACCAGTTGTGCTATATCGATCCTGGAATTGCAAGCGGGAAGGAAAAGGAGTTGCTTAAGACAATGGAAAGCGTCTTTCTTGAATTCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_C78

Protein Analysis

180

Amino Acids

20.45

Weight (kDa)

8.97

Isoelectric Point (pI)

27.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007168)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G24680
fragaria_vesca	FvH4_7g32290 FvH4_7g33360 FvH4_7g33361 FvH4_7g33700
malus_domestica	MD01G1231800.v1.1 MD01G1231900.v1.1 MD07G1303900.v1.1
prunus_persica	Prupe.2G322500_v2.0.a1 Prupe.2G322500_v2.0.a1 Prupe.2G322500_v2.0.a1 Prupe.2G322500_v2.0.a1
pyrus_communis	pycom01g24040 pycom07g27670 pycom07g27680
rosa_chinensis	RchiOBHm_Chr1g0383341
rosa_laevigata	RLG00000026111
rosa_multiflora	Rmu_sc0007173.1_g000014
rosa_roxburghii	Rroxscaffold_4G00277380
rosa_rugosa	Rorug01G0440600
rosa_samantha	Rh1AG466500 Rh1BG423800 Rh1CG437000 Rh1DG456500
rosa_wichuraiana	Rw1G040600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	486
AclWI	GGATC	2 cut(s)	185, 464
AcoI	YGGCCR	1 cut(s)	355
AcsI	RAATTY	2 cut(s)	64, 533
AfaI	GTAC	2 cut(s)	257, 452
AfiI	CCNNNNNNNGG	1 cut(s)	364
AflII	CTTAAG	1 cut(s)	506
AgsI	TTSAA	3 cut(s)	62, 299, 533
AjnI	CCWGG	2 cut(s)	352, 472
AluBI	AGCT	1 cut(s)	88
AluI	AGCT	1 cut(s)	88
AlwI	GGATC	2 cut(s)	185, 464
AoxI	GGCC	1 cut(s)	355
ApoI	RAATTY	2 cut(s)	64, 533
AsuHPI	GGTGA	1 cut(s)	104
BalI	TGGCCA	1 cut(s)	357
BccI	CCATC	2 cut(s)	263, 396
BciT130I	CCWGG	2 cut(s)	354, 474
BfaI	CTAG	1 cut(s)	538
BfrI	CTTAAG	1 cut(s)	506
BglII	AGATCT	1 cut(s)	370
Bme1390I	CCNGG	2 cut(s)	354, 474
BmrFI	CCNGG	2 cut(s)	354, 474
BmsI	GCATC	1 cut(s)	312
BpmI	CTGGAG	1 cut(s)	311
BpuEI	CTTGAG	1 cut(s)	24
Bsa29I	ATCGAT	1 cut(s)	468
BsaJI	CCNNGG	1 cut(s)	352
Bsc4I	CCNNNNNNNGG	1 cut(s)	364
Bse1I	ACTGG	2 cut(s)	51, 454
BseBI	CCWGG	2 cut(s)	354, 474
BseCI	ATCGAT	1 cut(s)	468
BseDI	CCNNGG	1 cut(s)	352
BseGI	GGATG	2 cut(s)	327, 407
BseLI	CCNNNNNNNGG	1 cut(s)	364
BseNI	ACTGG	2 cut(s)	51, 454
Bsh1285I	CGRYCG	1 cut(s)	157
BshFI	GGCC	1 cut(s)	357
BshVI	ATCGAT	1 cut(s)	468
BsiEI	CGRYCG	1 cut(s)	157
BslI	CCNNNNNNNGG	1 cut(s)	364
BsnI	GGCC	1 cut(s)	357
Bsp143I	GATC	4 cut(s)	177, 370, 380, 469
BspACI	CCGC	1 cut(s)	486
BspANI	GGCC	1 cut(s)	357
BspDI	ATCGAT	1 cut(s)	468
BspHI	TCATGA	1 cut(s)	28
BspPI	GGATC	2 cut(s)	185, 464
BspTI	CTTAAG	1 cut(s)	506
BsrI	ACTGG	2 cut(s)	51, 454
BssECI	CCNNGG	1 cut(s)	352
BssMI	GATC	4 cut(s)	177, 370, 380, 469
Bst2UI	CCWGG	2 cut(s)	354, 474
Bst4CI	ACNGT	2 cut(s)	155, 450
BstAFI	CTTAAG	1 cut(s)	506
BstC8I	GCNNGC	1 cut(s)	484
BstDEI	CTNAG	1 cut(s)	386
BstF5I	GGATG	2 cut(s)	327, 407
BstKTI	GATC	4 cut(s)	180, 373, 383, 472
BstMBI	GATC	4 cut(s)	177, 370, 380, 469
BstMCI	CGRYCG	1 cut(s)	157
BstMWI	GCNNNNNNNGC	1 cut(s)	442
BstNI	CCWGG	2 cut(s)	354, 474
BstSCI	CCNGG	2 cut(s)	352, 472
BstX2I	RGATCY	2 cut(s)	177, 370
BstXI	CCANNNNNNTGG	1 cut(s)	269
BstYI	RGATCY	2 cut(s)	177, 370
Bsu15I	ATCGAT	1 cut(s)	468
BsuRI	GGCC	1 cut(s)	357
BsuTUI	ATCGAT	1 cut(s)	468
BtsCI	GGATG	2 cut(s)	327, 407
BtsIMutI	CAGTG	2 cut(s)	58, 244
Cac8I	GCNNGC	1 cut(s)	484
CciI	TCATGA	1 cut(s)	28
ClaI	ATCGAT	1 cut(s)	468
CseI	GACGC	2 cut(s)	296, 511
Csp6I	GTAC	2 cut(s)	256, 451
CviAII	CATG	2 cut(s)	29, 266
CviJI	RGCY	3 cut(s)	88, 357, 445
CviKI_1	RGCY	3 cut(s)	88, 357, 445
CviQI	GTAC	2 cut(s)	256, 451
DdeI	CTNAG	1 cut(s)	386
DpnI	GATC	4 cut(s)	179, 372, 382, 471
DpnII	GATC	4 cut(s)	177, 370, 380, 469
EaeI	YGGCCR	1 cut(s)	355
EcoRI	GAATTC	1 cut(s)	533
EcoRII	CCWGG	2 cut(s)	352, 472
FaeI	CATG	2 cut(s)	32, 269
FaiI	YATR	6 cut(s)	30, 101, 267, 315, 360, 465
FatI	CATG	2 cut(s)	28, 265
FauI	CCCGC	1 cut(s)	479
FokI	GGATG	2 cut(s)	334, 414
FspBI	CTAG	1 cut(s)	538
GsuI	CTGGAG	1 cut(s)	311
HaeIII	GGCC	1 cut(s)	357
HgaI	GACGC	2 cut(s)	296, 511
Hin1II	CATG	2 cut(s)	32, 269
HincII	GTYRAC	1 cut(s)	311
HindII	GTYRAC	1 cut(s)	311
HinfI	GANTC	3 cut(s)	25, 95, 295
HphI	GGTGA	1 cut(s)	104
Hpy166II	GTNNAC	4 cut(s)	56, 138, 311, 430
Hpy188I	TCNGA	1 cut(s)	196
Hpy188III	TCNNGA	8 cut(s)	29, 69, 126, 181, 216, 279, 374, 530
Hpy8I	GTNNAC	4 cut(s)	56, 138, 311, 430
HpyAV	CCTTC	1 cut(s)	484
HpyCH4III	ACNGT	2 cut(s)	155, 450
HpyCH4V	TGCA	1 cut(s)	482
HpyF10VI	GCNNNNNNNGC	1 cut(s)	442
HpyF3I	CTNAG	1 cut(s)	386
Hsp92II	CATG	2 cut(s)	32, 269
Kzo9I	GATC	4 cut(s)	177, 370, 380, 469
LmnI	GCTCC	1 cut(s)	330
LweI	GCATC	1 cut(s)	312
MaeI	CTAG	1 cut(s)	538
MaeIII	GTNAC	2 cut(s)	92, 239
MalI	GATC	4 cut(s)	179, 372, 382, 471
MboI	GATC	4 cut(s)	177, 370, 380, 469
MboII	GAAGA	1 cut(s)	380
MflI	RGATCY	2 cut(s)	177, 370
MlsI	TGGCCA	1 cut(s)	357
MluCI	AATT	4 cut(s)	64, 202, 477, 533
MluNI	TGGCCA	1 cut(s)	357
MlyI	GAGTC	1 cut(s)	89
MmeI	TCCRAC	1 cut(s)	286
MnlI	CCTC	2 cut(s)	65, 416
Mox20I	TGGCCA	1 cut(s)	357
MscI	TGGCCA	1 cut(s)	357
MseI	TTAA	2 cut(s)	341, 507
Msp20I	TGGCCA	1 cut(s)	357
MspCI	CTTAAG	1 cut(s)	506
MspR9I	CCNGG	2 cut(s)	354, 474
MvaI	CCWGG	2 cut(s)	354, 474
MwoI	GCNNNNNNNGC	1 cut(s)	442
NdeII	GATC	4 cut(s)	177, 370, 380, 469
NlaIII	CATG	2 cut(s)	32, 269
NmuCI	GTSAC	2 cut(s)	92, 239
PagI	TCATGA	1 cut(s)	28
PfeI	GAWTC	2 cut(s)	25, 295
PfoI	TCCNGGA	1 cut(s)	472
PleI	GAGTC	1 cut(s)	89
PpsI	GAGTC	1 cut(s)	89
Psp6I	CCWGG	2 cut(s)	352, 472
PspGI	CCWGG	2 cut(s)	352, 472
PsuI	RGATCY	2 cut(s)	177, 370
RsaI	GTAC	2 cut(s)	257, 452
RsaNI	GTAC	2 cut(s)	256, 451
SaqAI	TTAA	2 cut(s)	341, 507
Sau3AI	GATC	4 cut(s)	177, 370, 380, 469
SchI	GAGTC	1 cut(s)	89
ScrFI	CCNGG	2 cut(s)	354, 474
SetI	ASST	5 cut(s)	11, 76, 90, 165, 231
SfaNI	GCATC	1 cut(s)	312
SmlI	CTYRAG	2 cut(s)	39, 506
SmoI	CTYRAG	2 cut(s)	39, 506
Sse9I	AATT	4 cut(s)	64, 202, 477, 533
SsiI	CCGC	1 cut(s)	486
SspI	AATATT	1 cut(s)	345
SspMI	CTAG	1 cut(s)	538
StyD4I	CCNGG	2 cut(s)	352, 472
TaaI	ACNGT	2 cut(s)	155, 450
TaqI	TCGA	2 cut(s)	278, 468
TasI	AATT	4 cut(s)	64, 202, 477, 533
TatI	WGTACW	1 cut(s)	255
TfiI	GAWTC	2 cut(s)	25, 295
Tru1I	TTAA	2 cut(s)	341, 507
Tru9I	TTAA	2 cut(s)	341, 507
TscAI	CASTG	2 cut(s)	58, 244
TseFI	GTSAC	2 cut(s)	92, 239
Tsp45I	GTSAC	2 cut(s)	92, 239
TspGWI	ACGGA	1 cut(s)	380
TspRI	CASTG	2 cut(s)	58, 244
Vha464I	CTTAAG	1 cut(s)	506
XapI	RAATTY	2 cut(s)	64, 533
XspI	CTAG	1 cut(s)	538

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.