Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007173.1

Orthogroup ID

OG0007168

Physical Location & Seq

Genomic Coordinates Reverse (-)

60574 .. 62837

Gene Structure 2264 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007173.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1332 bp

atgagtgctatggattcttcttcgtcttcctgccccttctgtaatctcacagttccatcctcacaacttgaacggcatgccaatagtcactttgaggttgaagatgagcaactggctatggacttggagtttgcccagcaacttgctttggaaccttcttctccaccgtccatgaataatcaaacaatcagagacttgccattagcaagatttcatggacaatgtagcatggaggagagtatctcctgcctggctgctttacagactagaaccactttccatgaaattgaaggtggtgtgatggctctgctgagagagtgtttggagttagaacctagagatacaacgacttttttgtgtggttatacagatcatattcagagcattcgatctgaggattctgggtggggttgtgggtggcgtaacatccaaatgcttagctcccatttgcttatgcaaaggcaagagactcgagaagttttgtttggtggtgcaggatttgttcctgatatcccatcactccaaagatggcttgagattgcttgggaaaagggatttgatgcagctggctctgatcagtttgctaacaaaatttatggcttgaaaagatggattggaacaactgaatgtgctgctattttccgttcttttgggctgcgagcaaggatagtggattttggtcctaaggaactcgaaccatattatcattctcttcctggttcaaggcttggggaagaggtcaagagaatacataatggtgggaagaggaaagcaattcaggtttgtggaccgatggatagatatttgccagaaaggagtcatgatattaaccaagcaagttccagttgccgtgaaaagtcgagttgttctactagccatataggtgattcttggggtaggaaaagtaattataattcgggaaataagttttcaaagaaaagcaagggtcatcaggttctcatggattggatctggaattactttaatgatggtaacgttaccaaaacgggcaatcaccaggtcattgttagtgacaaaacacccttgtactttcaacatgatgggcattcgagaaccattgttgggattcaagtcaaaaatcaacataacgggatgcagcaacacactctcttaattttggaccctggtcatagaacggcagacctggaaagatcgctgaaggaaaagagaggatggcagaagtttataaaaagaggagttcacacactgagaaagccacagtaccagttgtgttatattgatcctggcatttcaagtggagatgaagtggagttactcaagactgtagatagtgtttttcttgaactctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_C78

Protein Analysis

443

Amino Acids

50.13

Weight (kDa)

6.66

Isoelectric Point (pI)

53.12

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007168)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G24680
fragaria_vesca	FvH4_7g32290 FvH4_7g33360 FvH4_7g33361 FvH4_7g33700
malus_domestica	MD01G1231800.v1.1 MD01G1231900.v1.1 MD07G1303900.v1.1
prunus_persica	Prupe.2G322500_v2.0.a1 Prupe.2G322500_v2.0.a1 Prupe.2G322500_v2.0.a1 Prupe.2G322500_v2.0.a1
pyrus_communis	pycom01g24040 pycom07g27670 pycom07g27680
rosa_chinensis	RchiOBHm_Chr1g0383341
rosa_laevigata	RLG00000026111
rosa_multiflora	Rmu_sc0007173.1_g000014
rosa_roxburghii	Rroxscaffold_4G00277380
rosa_rugosa	Rorug01G0440600
rosa_samantha	Rh1AG466500 Rh1BG423800 Rh1CG437000 Rh1DG456500
rosa_wichuraiana	Rw1G040600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	912, 1208
AclI	AACGTT	1 cut(s)	996
AclWI	GGATC	2 cut(s)	977, 1256
AcsI	RAATTY	1 cut(s)	591
AcuI	CTGAAG	1 cut(s)	1199
AfaI	GTAC	2 cut(s)	1049, 1244
AfiI	CCNNNNNNNGG	1 cut(s)	1083
AjnI	CCWGG	6 cut(s)	249, 715, 1017, 1144, 1164, 1264
AjuI	GAANNNNNNNTTGG	2 cut(s)	468, 500
AluBI	AGCT	2 cut(s)	441, 566
AluI	AGCT	2 cut(s)	441, 566
Alw26I	GTCTC	2 cut(s)	186, 461
AlwI	GGATC	2 cut(s)	977, 1256
Ama87I	CYCGRG	1 cut(s)	471
ApeKI	GCWGC	5 cut(s)	254, 563, 632, 655, 1117
ApoI	RAATTY	1 cut(s)	591
ArsI	GACNNNNNNTTYG	2 cut(s)	113, 145
AspS9I	GGNCC	3 cut(s)	680, 788, 1141
AsuHPI	GGTGA	2 cut(s)	896, 1007
AvaI	CYCGRG	1 cut(s)	471
AvaII	GGWCC	3 cut(s)	680, 788, 1141
AxyI	CCTNAGG	1 cut(s)	684
BarI	GAAGNNNNNNTAC	2 cut(s)	1278, 1310
BbsI	GAAGAC	1 cut(s)	18
BbvI	GCAGC	5 cut(s)	241, 575, 619, 642, 1129
BccI	CCATC	9 cut(s)	64, 295, 522, 523, 603, 787, 983, 1055, 1188
BceAI	ACGGC	3 cut(s)	89, 834, 1173
BcgI	CGANNNNNNTGC	2 cut(s)	452, 486
BciT130I	CCWGG	6 cut(s)	251, 717, 1019, 1146, 1166, 1266
BclI	TGATCA	1 cut(s)	574
BcoDI	GTCTC	2 cut(s)	186, 461
BfaI	CTAG	4 cut(s)	267, 336, 873, 1330
BfmI	CTRYAG	1 cut(s)	1305
BisI	GCNGC	5 cut(s)	255, 564, 633, 656, 1118
BlpI	GCTNAGC	1 cut(s)	437
BlsI	GCNGC	5 cut(s)	256, 565, 634, 657, 1119
Bme1390I	CCNGG	6 cut(s)	251, 717, 1019, 1146, 1166, 1266
Bme18I	GGWCC	3 cut(s)	680, 788, 1141
BmeT110I	CYCGRG	1 cut(s)	471
BmgT120I	GGNCC	3 cut(s)	680, 788, 1141
BmiI	GGNNCC	2 cut(s)	153, 1143
BmrFI	CCNGG	6 cut(s)	251, 717, 1019, 1146, 1166, 1266
BmsI	GCATC	2 cut(s)	550, 1104
BoxI	GACNNNNGTC	1 cut(s)	1146
BpiI	GAAGAC	1 cut(s)	18
BplI	GAGNNNNNCTC	2 cut(s)	227, 259
Bpu1102I	GCTNAGC	1 cut(s)	437
BpuEI	CTTGAG	2 cut(s)	554, 1283
BsaJI	CCNNGG	1 cut(s)	1144
BsaXI	ACNNNNNCTCC	2 cut(s)	1272, 1302
Bsc4I	CCNNNNNNNGG	1 cut(s)	1083
Bse1I	ACTGG	3 cut(s)	117, 843, 1246
Bse21I	CCTNAGG	1 cut(s)	684
BseBI	CCWGG	6 cut(s)	251, 717, 1019, 1146, 1166, 1266
BseDI	CCNNGG	1 cut(s)	1144
BseGI	GGATG	4 cut(s)	56, 426, 1119, 1199
BseLI	CCNNNNNNNGG	1 cut(s)	1083
BseMII	CTCAG	3 cut(s)	302, 384, 1220
BseNI	ACTGG	3 cut(s)	117, 843, 1246
BseRI	GAGGAG	2 cut(s)	248, 1230
BseXI	GCAGC	5 cut(s)	241, 575, 619, 642, 1129
BseYI	CCCAGC	1 cut(s)	135
BsgI	GTGCAG	1 cut(s)	513
BsiHKCI	CYCGRG	1 cut(s)	471
BslI	CCNNNNNNNGG	1 cut(s)	1083
BsmAI	GTCTC	2 cut(s)	186, 461
BsmI	GAATGC	2 cut(s)	384, 1066
BsoBI	CYCGRG	1 cut(s)	471
Bsp143I	GATC	6 cut(s)	370, 389, 574, 969, 1172, 1261
Bsp1720I	GCTNAGC	1 cut(s)	437
BspCNI	CTCAG	3 cut(s)	303, 385, 1221
BspHI	TCATGA	1 cut(s)	820
BspLI	GGNNCC	2 cut(s)	153, 1143
BspPI	GGATC	2 cut(s)	977, 1256
BsrI	ACTGG	3 cut(s)	117, 843, 1246
BssECI	CCNNGG	1 cut(s)	1144
BssMI	GATC	6 cut(s)	370, 389, 574, 969, 1172, 1261
Bst2UI	CCWGG	6 cut(s)	251, 717, 1019, 1146, 1166, 1266
Bst4CI	ACNGT	4 cut(s)	52, 168, 1242, 1306
Bst6I	CTCTTC	3 cut(s)	717, 729, 758
BstC8I	GCNNGC	3 cut(s)	78, 568, 660
BstDEI	CTNAG	5 cut(s)	311, 393, 437, 684, 1229
BstF5I	GGATG	4 cut(s)	56, 426, 1119, 1199
BstKTI	GATC	6 cut(s)	373, 392, 577, 972, 1175, 1264
BstMAI	GTCTC	2 cut(s)	186, 461
BstMBI	GATC	6 cut(s)	370, 389, 574, 969, 1172, 1261
BstNI	CCWGG	6 cut(s)	251, 717, 1019, 1146, 1166, 1266
BstNSI	RCATGY	1 cut(s)	80
BstPAI	GACNNNNGTC	1 cut(s)	1146
BstSCI	CCNGG	6 cut(s)	249, 715, 1017, 1144, 1164, 1264
BstSFI	CTRYAG	1 cut(s)	1305
BstV1I	GCAGC	5 cut(s)	241, 575, 619, 642, 1129
BstV2I	GAAGAC	1 cut(s)	18
BstX2I	RGATCY	1 cut(s)	969
BstYI	RGATCY	1 cut(s)	969
Bsu36I	CCTNAGG	1 cut(s)	684
BtsCI	GGATG	4 cut(s)	56, 426, 1119, 1199
BtsIMutI	CAGTG	1 cut(s)	1226
Cac8I	GCNNGC	3 cut(s)	78, 568, 660
CciI	TCATGA	1 cut(s)	820
Cfr13I	GGNCC	3 cut(s)	680, 788, 1141
CsiI	ACCWGGT	1 cut(s)	1017
Csp6I	GTAC	2 cut(s)	1048, 1243
CspCI	CAANNNNNGTGG	2 cut(s)	651, 686
CviAII	CATG	8 cut(s)	77, 172, 215, 229, 281, 821, 961, 1058
CviQI	GTAC	2 cut(s)	1048, 1243
DdeI	CTNAG	5 cut(s)	311, 393, 437, 684, 1229
DpnI	GATC	6 cut(s)	372, 391, 576, 971, 1174, 1263
DpnII	GATC	6 cut(s)	370, 389, 574, 969, 1172, 1261
Eam1104I	CTCTTC	3 cut(s)	717, 729, 758
EarI	CTCTTC	3 cut(s)	717, 729, 758
Eco32I	GATATC	1 cut(s)	511
Eco47I	GGWCC	3 cut(s)	680, 788, 1141
Eco57I	CTGAAG	1 cut(s)	1199
Eco81I	CCTNAGG	1 cut(s)	684
Eco88I	CYCGRG	1 cut(s)	471
EcoRII	CCWGG	6 cut(s)	249, 715, 1017, 1144, 1164, 1264
EcoRV	GATATC	1 cut(s)	511
FaeI	CATG	8 cut(s)	80, 175, 218, 232, 284, 824, 964, 1061
FatI	CATG	8 cut(s)	76, 171, 214, 228, 280, 820, 960, 1057
FbaI	TGATCA	1 cut(s)	574
Fnu4HI	GCNGC	5 cut(s)	255, 564, 633, 656, 1118
FokI	GGATG	4 cut(s)	43, 413, 1126, 1206
Fsp4HI	GCNGC	5 cut(s)	255, 564, 633, 656, 1118
FspBI	CTAG	4 cut(s)	267, 336, 873, 1330
GluI	GCNGC	5 cut(s)	255, 564, 633, 656, 1118
GsaI	CCCAGC	1 cut(s)	139
Hin1II	CATG	8 cut(s)	80, 175, 218, 232, 284, 824, 964, 1061
HinfI	GANTC	6 cut(s)	14, 398, 469, 817, 887, 1087
HphI	GGTGA	2 cut(s)	896, 1007
Hpy166II	GTNNAC	2 cut(s)	788, 1222
Hpy188I	TCNGA	4 cut(s)	191, 381, 394, 574
Hpy188III	TCNNGA	9 cut(s)	473, 506, 742, 821, 918, 973, 1071, 1300, 1322
Hpy8I	GTNNAC	2 cut(s)	788, 1222
HpyAV	CCTTC	4 cut(s)	46, 165, 284, 1174
HpyCH4III	ACNGT	4 cut(s)	52, 168, 1242, 1306
HpyCH4IV	ACGT	1 cut(s)	996
HpyCH4V	TGCA	4 cut(s)	457, 494, 563, 1117
HpyF3I	CTNAG	5 cut(s)	311, 393, 437, 684, 1229
HpySE526I	ACGT	1 cut(s)	996
Hsp92II	CATG	8 cut(s)	80, 175, 218, 232, 284, 824, 964, 1061
Ksp22I	TGATCA	1 cut(s)	574
Kzo9I	GATC	6 cut(s)	370, 389, 574, 969, 1172, 1261
LmnI	GCTCC	1 cut(s)	446
Lsp1109I	GCAGC	5 cut(s)	241, 575, 619, 642, 1129
LweI	GCATC	2 cut(s)	550, 1104
MabI	ACCWGGT	1 cut(s)	1017
MaeI	CTAG	4 cut(s)	267, 336, 873, 1330
MaeII	ACGT	1 cut(s)	996
MaeIII	GTNAC	6 cut(s)	86, 422, 992, 997, 1031, 1293
MalI	GATC	6 cut(s)	372, 391, 576, 971, 1174, 1263
MboI	GATC	6 cut(s)	370, 389, 574, 969, 1172, 1261
MboII	GAAGA	8 cut(s)	9, 12, 18, 113, 150, 704, 746, 775
MflI	RGATCY	1 cut(s)	969
MluCI	AATT	7 cut(s)	285, 591, 774, 907, 913, 976, 1134
MlyI	GAGTC	2 cut(s)	463, 826
MnlI	CCTC	8 cut(s)	70, 88, 226, 388, 730, 759, 1184, 1208
MseI	TTAA	3 cut(s)	828, 984, 1133
MslI	CAYNNNNRTG	3 cut(s)	431, 756, 882
MspA1I	CMGCKG	1 cut(s)	566
MspR9I	CCNGG	6 cut(s)	251, 717, 1019, 1146, 1166, 1266
Mva1269I	GAATGC	2 cut(s)	384, 1066
MvaI	CCWGG	6 cut(s)	251, 717, 1019, 1146, 1166, 1266
NdeII	GATC	6 cut(s)	370, 389, 574, 969, 1172, 1261
NlaIII	CATG	8 cut(s)	80, 175, 218, 232, 284, 824, 964, 1061
NlaIV	GGNNCC	2 cut(s)	153, 1143
NmuCI	GTSAC	2 cut(s)	86, 1031
NspI	RCATGY	1 cut(s)	80
PaeI	GCATGC	1 cut(s)	80
PaeR7I	CTCGAG	1 cut(s)	471
PagI	TCATGA	1 cut(s)	820
PctI	GAATGC	2 cut(s)	384, 1066
PfeI	GAWTC	4 cut(s)	14, 398, 887, 1087
PkrI	GCNGC	5 cut(s)	256, 565, 634, 657, 1119
PleI	GAGTC	2 cut(s)	463, 825
PpsI	GAGTC	2 cut(s)	463, 825
PshAI	GACNNNNGTC	1 cut(s)	1146
PsiI	TTATAA	2 cut(s)	912, 1208
Psp1406I	AACGTT	1 cut(s)	996
Psp6I	CCWGG	6 cut(s)	249, 715, 1017, 1144, 1164, 1264
PspFI	CCCAGC	1 cut(s)	135
PspGI	CCWGG	6 cut(s)	249, 715, 1017, 1144, 1164, 1264
PspN4I	GGNNCC	2 cut(s)	153, 1143
PspPI	GGNCC	3 cut(s)	680, 788, 1141
PsuI	RGATCY	1 cut(s)	969
PvuII	CAGCTG	1 cut(s)	566
RsaI	GTAC	2 cut(s)	1049, 1244
RsaNI	GTAC	2 cut(s)	1048, 1243
RseI	CAYNNNNRTG	3 cut(s)	431, 756, 882
SaqAI	TTAA	3 cut(s)	828, 984, 1133
SatI	GCNGC	5 cut(s)	255, 564, 633, 656, 1118
Sau3AI	GATC	6 cut(s)	370, 389, 574, 969, 1172, 1261
Sau96I	GGNCC	3 cut(s)	680, 788, 1141
SchI	GAGTC	2 cut(s)	463, 826
ScrFI	CCNGG	6 cut(s)	251, 717, 1019, 1146, 1166, 1266
SexAI	ACCWGGT	1 cut(s)	1017
SfaNI	GCATC	2 cut(s)	550, 1104
SfcI	CTRYAG	1 cut(s)	1305
Sfr274I	CTCGAG	1 cut(s)	471
SinI	GGWCC	3 cut(s)	680, 788, 1141
SlaI	CTCGAG	1 cut(s)	471
SmiMI	CAYNNNNRTG	3 cut(s)	431, 756, 882
SmlI	CTYRAG	3 cut(s)	471, 533, 1298
SmoI	CTYRAG	3 cut(s)	471, 533, 1298
SphI	GCATGC	1 cut(s)	80
Sse9I	AATT	7 cut(s)	285, 591, 774, 907, 913, 976, 1134
SspMI	CTAG	4 cut(s)	267, 336, 873, 1330
StyD4I	CCNGG	6 cut(s)	249, 715, 1017, 1144, 1164, 1264
TaaI	ACNGT	4 cut(s)	52, 168, 1242, 1306
TaiI	ACGT	1 cut(s)	999
TaqI	TCGA	5 cut(s)	388, 472, 693, 860, 1070
TaqII	GACCGA	1 cut(s)	805
TasI	AATT	7 cut(s)	285, 591, 774, 907, 913, 976, 1134
TatI	WGTACW	1 cut(s)	1047
TfiI	GAWTC	4 cut(s)	14, 398, 887, 1087
Tru1I	TTAA	3 cut(s)	828, 984, 1133
Tru9I	TTAA	3 cut(s)	828, 984, 1133
TscAI	CASTG	1 cut(s)	1233
TseFI	GTSAC	2 cut(s)	86, 1031
TseI	GCWGC	5 cut(s)	254, 563, 632, 655, 1117
Tsp45I	GTSAC	2 cut(s)	86, 1031
TspDTI	ATGAA	4 cut(s)	188, 203, 297, 1299
TspGWI	ACGGA	1 cut(s)	632
TspRI	CASTG	1 cut(s)	1233
VpaK11BI	GGWCC	3 cut(s)	680, 788, 1141
XapI	RAATTY	1 cut(s)	591
XceI	RCATGY	1 cut(s)	80
XhoI	CTCGAG	1 cut(s)	471
XspI	CTAG	4 cut(s)	267, 336, 873, 1330

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.