Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr3

Orthogroup ID

OG0003315

Physical Location & Seq

Genomic Coordinates Forward (+)

6905476 .. 6905963

Gene Structure 488 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom03g08560.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 186 bp

ATGTATAAGACGGCTTCGATTCACTTGTTTGTTGCAGGAGTTTTCTATTGTGGAAGTCCAACACTTACCAAAACACTCAGGAAGCTCTGCCTAGAATTTAGTCTAAACTCAGCAACTCGGTTTGTCTTCCACAAGGAGAACTTCGAAGTCCTTGATACTAACTACTCCCTTGTTTCAACTGGATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04013 ko04624 map04013 map04624

Pfam Domains

Protein Families

EF-hand_6 FAD_binding_8 Ferric_reduct NADPH_Ox NAD_binding_6

Protein Analysis

62

Amino Acids

6.9

Weight (kDa)

8.71

Isoelectric Point (pI)

28.31

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003315)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G19230 AT1G19230
fragaria_vesca	FvH4_1g09270 FvH4_1g09270 FvH4_1g09270 FvH4_1g09270
malus_domestica	MD02G1099900.v1.1 MD12G1213800.v1.1 MD15G1222800.v1.1
prunus_persica	Prupe.7G193000_v2.0.a1 Prupe.7G193000_v2.0.a1 Prupe.7G193000_v2.0.a1 Prupe.7G193000_v2.0.a1
pyrus_communis	pycom02g07780 pycom03g08560 pycom06g11890
rosa_chinensis	RchiOBHm_Chr2g0095831 RchiOBHm_Chr2g0103601
rosa_laevigata	RLG00000016598 RLG00000017348
rosa_multiflora	Rmu_co8313273.1_g000001 Rmu_sc0000496.1_g000009 Rmu_sc0008750.1_g000011
rosa_roxburghii	Rroxscaffold_2G00146050
rosa_rugosa	Rorug02G0053200 Rorug02G0053200 Rorug02G0116200 Rorug02G0116300.1
rosa_samantha	Rh2AG102100 Rh2BG103600 Rh2CG106000 Rh2CG171000 Rh2DG103700 Rh4BG287500
rosa_wichuraiana	Rw2G007750 Rw2G012920

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	95
AgsI	TTSAA	1 cut(s)	177
AluBI	AGCT	1 cut(s)	85
AluI	AGCT	1 cut(s)	85
ApoI	RAATTY	1 cut(s)	95
AsuII	TTCGAA	1 cut(s)	144
BbsI	GAAGAC	1 cut(s)	118
BceAI	ACGGC	1 cut(s)	27
BfaI	CTAG	1 cut(s)	92
BpiI	GAAGAC	1 cut(s)	118
Bpu14I	TTCGAA	1 cut(s)	144
Bse1I	ACTGG	1 cut(s)	184
BseMII	CTCAG	2 cut(s)	91, 123
BseNI	ACTGG	1 cut(s)	184
Bsp119I	TTCGAA	1 cut(s)	144
BspCNI	CTCAG	2 cut(s)	90, 122
BspT104I	TTCGAA	1 cut(s)	144
BsrI	ACTGG	1 cut(s)	184
BstBI	TTCGAA	1 cut(s)	144
BstDEI	CTNAG	2 cut(s)	77, 109
BstV2I	GAAGAC	1 cut(s)	118
CviJI	RGCY	2 cut(s)	14, 85
CviKI_1	RGCY	2 cut(s)	14, 85
DdeI	CTNAG	2 cut(s)	77, 109
FaiI	YATR	1 cut(s)	6
FalI	AAGNNNNNCTT	2 cut(s)	125, 157
FspBI	CTAG	1 cut(s)	92
HinfI	GANTC	1 cut(s)	19
Hpy188III	TCNNGA	1 cut(s)	79
HpyCH4V	TGCA	1 cut(s)	35
HpyF3I	CTNAG	2 cut(s)	77, 109
LpnPI	CCDG	3 cut(s)	21, 64, 165
MaeI	CTAG	1 cut(s)	92
MboII	GAAGA	1 cut(s)	118
MluCI	AATT	1 cut(s)	95
MmeI	TCCRAC	1 cut(s)	83
NspV	TTCGAA	1 cut(s)	144
PfeI	GAWTC	1 cut(s)	19
SetI	ASST	1 cut(s)	87
SfuI	TTCGAA	1 cut(s)	144
SgeI	CNNG	8 cut(s)	37, 48, 91, 104, 129, 145, 164, 182
Sse9I	AATT	1 cut(s)	95
SspMI	CTAG	1 cut(s)	92
TaqI	TCGA	2 cut(s)	17, 144
TasI	AATT	1 cut(s)	95
TfiI	GAWTC	1 cut(s)	19
XapI	RAATTY	1 cut(s)	95
XspI	CTAG	1 cut(s)	92

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.