Rh2CG171000

Respiratory burst oxidase homolog protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0003315
Physical Location & Seq
Forward (+)
15310541 .. 15311055
515 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG171000.1

Sequence Viewer

Length: 330 bp
ATGCTCATTTCTATTGGGTTACCTGGCTCTTTTGAGTGGTTTAAAGGAGTCATGGATGAAGTGGCAGAAATGGATATCAAAGGTCAGATTGAACTTCACAACTACCTTACGAGTGTCTACGAAGAGGGTGATGCAAGGTCAACTCTAATCACCATGGTCCAAGCTCTCAACCATGCCAAACTTGGAGTTGACATCCTATCTGGCACCAGAGTAATGACTCATTTTGCAAGACCTAATTGGAAAGAAGTGTTTACCAAGATAGCTTCCAAGCATCCATTTTCGACAGTGGGTGAAGATAATCTACCAGAAGTCCAGAACTATACACGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04016 ko04626 map04016 map04626
Pfam Domains
Protein Families
FAD_binding_8 Ferric_reduct NADPH_Ox NAD_binding_6

Protein Analysis

109

Amino Acids

12.3

Weight (kDa)

5.47

Isoelectric Point (pI)

20.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAD_binding_6 PF08030 8 - 97 1.2e-23 Ferric reductase NAD binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 203
AccI GTMKAC 1 cut(s) 117
AflIII ACRYGT 1 cut(s) 323
AgsI TTSAA 1 cut(s) 92
AjnI CCWGG 1 cut(s) 22
AluBI AGCT 2 cut(s) 164, 263
AluI AGCT 2 cut(s) 164, 263
AspS9I GGNCC 1 cut(s) 157
AsuHPI GGTGA 3 cut(s) 140, 142, 302
AvaII GGWCC 1 cut(s) 157
BanI GGYRCC 1 cut(s) 203
BarI GAAGNNNNNNTAC 2 cut(s) 285, 317
BciT130I CCWGG 1 cut(s) 24
Bme1390I CCNGG 1 cut(s) 24
Bme18I GGWCC 1 cut(s) 157
BmgT120I GGNCC 1 cut(s) 157
BmiI GGNNCC 1 cut(s) 205
BmrFI CCNGG 1 cut(s) 24
BmsI GCATC 2 cut(s) 121, 280
BsaJI CCNNGG 1 cut(s) 153
BseBI CCWGG 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 153
BseGI GGATG 3 cut(s) 61, 192, 271
BshNI GGYRCC 1 cut(s) 203
Bsp19I CCATGG 1 cut(s) 153
BspLI GGNNCC 1 cut(s) 205
BspT107I GGYRCC 1 cut(s) 203
BssECI CCNNGG 1 cut(s) 153
BssT1I CCWWGG 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 24
Bst4CI ACNGT 1 cut(s) 286
Bst6I CTCTTC 1 cut(s) 117
BstDSI CCRYGG 1 cut(s) 153
BstEII GGTNACC 1 cut(s) 18
BstF5I GGATG 3 cut(s) 61, 192, 271
BstNI CCWGG 1 cut(s) 24
BstPI GGTNACC 1 cut(s) 18
BstSCI CCNGG 1 cut(s) 22
BtgI CCRYGG 1 cut(s) 153
BtsCI GGATG 3 cut(s) 61, 192, 271
BtsIMutI CAGTG 1 cut(s) 291
Cfr13I GGNCC 1 cut(s) 157
CviAII CATG 3 cut(s) 52, 154, 173
CviJI RGCY 3 cut(s) 27, 164, 263
CviKI_1 RGCY 3 cut(s) 27, 164, 263
DraI TTTAAA 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 117
EarI CTCTTC 1 cut(s) 117
Eco130I CCWWGG 1 cut(s) 153
Eco32I GATATC 1 cut(s) 76
Eco47I GGWCC 1 cut(s) 157
Eco91I GGTNACC 1 cut(s) 18
EcoO65I GGTNACC 1 cut(s) 18
EcoRII CCWGG 1 cut(s) 22
EcoRV GATATC 1 cut(s) 76
EcoT14I CCWWGG 1 cut(s) 153
ErhI CCWWGG 1 cut(s) 153
FaeI CATG 3 cut(s) 55, 157, 176
FaiI YATR 4 cut(s) 53, 155, 174, 321
FatI CATG 3 cut(s) 51, 153, 172
FblI GTMKAC 1 cut(s) 117
FokI GGATG 3 cut(s) 68, 179, 258
Hin1II CATG 3 cut(s) 55, 157, 176
HincII GTYRAC 2 cut(s) 141, 190
HindII GTYRAC 2 cut(s) 141, 190
HinfI GANTC 2 cut(s) 48, 217
HphI GGTGA 3 cut(s) 140, 142, 302
Hpy166II GTNNAC 4 cut(s) 118, 141, 190, 252
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 1 cut(s) 313
Hpy8I GTNNAC 4 cut(s) 118, 141, 190, 252
HpyCH4III ACNGT 1 cut(s) 286
HpyCH4IV ACGT 1 cut(s) 325
HpyCH4V TGCA 2 cut(s) 134, 227
HpySE526I ACGT 1 cut(s) 325
Hsp92II CATG 3 cut(s) 55, 157, 176
LpnPI CCDG 6 cut(s) 9, 36, 186, 220, 318, 326
LweI GCATC 2 cut(s) 121, 280
MaeII ACGT 1 cut(s) 325
MaeIII GTNAC 1 cut(s) 18
MboII GAAGA 2 cut(s) 134, 305
MluCI AATT 1 cut(s) 235
MlyI GAGTC 2 cut(s) 57, 211
MnlI CCTC 1 cut(s) 118
MseI TTAA 2 cut(s) 42, 328
MspR9I CCNGG 1 cut(s) 24
MvaI CCWGG 1 cut(s) 24
NcoI CCATGG 1 cut(s) 153
NlaIII CATG 3 cut(s) 55, 157, 176
NlaIV GGNNCC 1 cut(s) 205
PleI GAGTC 2 cut(s) 56, 211
PpsI GAGTC 2 cut(s) 56, 211
Psp6I CCWGG 1 cut(s) 22
PspEI GGTNACC 1 cut(s) 18
PspGI CCWGG 1 cut(s) 22
PspN4I GGNNCC 1 cut(s) 205
PspPI GGNCC 1 cut(s) 157
SaqAI TTAA 2 cut(s) 42, 328
Sau96I GGNCC 1 cut(s) 157
SchI GAGTC 2 cut(s) 57, 211
ScrFI CCNGG 1 cut(s) 24
SetI ASST 8 cut(s) 25, 85, 108, 140, 166, 235, 265, 328
SfaNI GCATC 2 cut(s) 121, 280
SinI GGWCC 1 cut(s) 157
Sse9I AATT 1 cut(s) 235
StyD4I CCNGG 1 cut(s) 22
StyI CCWWGG 1 cut(s) 153
TaaI ACNGT 1 cut(s) 286
TaiI ACGT 1 cut(s) 328
TaqI TCGA 1 cut(s) 281
TasI AATT 1 cut(s) 235
Tru1I TTAA 2 cut(s) 42, 328
Tru9I TTAA 2 cut(s) 42, 328
TscAI CASTG 1 cut(s) 291
TspDTI ATGAA 1 cut(s) 72
TspRI CASTG 1 cut(s) 291
VpaK11BI GGWCC 1 cut(s) 157
XcmI CCANNNNNNNNNTGG 1 cut(s) 179
XmiI GTMKAC 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.