pycom04g15060

Regulatory-associated protein of TOR

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Reverse (-)
17865865 .. 17866170
306 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g15060.1

Sequence Viewer

Length: 306 bp
ATGACTCAGTTTATGCAGCAAAATGACCTCGCTGCATTGCAGCAATCCATGAAAGTTATGACCTCACGTACCATTGCACCACCACAAATATTACTAATCATTGCCAGTGGCTCGGCCAAACAGCTCATAAAAATCTTCAGTTTGGAGGGGGAACAGTTAGGCATCATAACATACTACCCTTACTTTATGGCTCAGAAGATCGGTCCTGTTAGTTGCCTAGCCTTCCATCCCTACCAAGTGCTGCTTGCAGTTGGTGCTGCAGATGCTTTTGCATCCATTTATGCTGATGACAACTCCCAAGTTTAG
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.05

Weight (kDa)

5.53

Isoelectric Point (pI)

37.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 114
AcuI CTGAAG 1 cut(s) 121
AfaI GTAC 1 cut(s) 70
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
AoxI GGCC 1 cut(s) 114
ApeKI GCWGC 5 cut(s) 16, 32, 40, 241, 257
AspS9I GGNCC 1 cut(s) 203
AvaII GGWCC 1 cut(s) 203
BbvI GCAGC 5 cut(s) 19, 28, 52, 228, 244
BccI CCATC 1 cut(s) 234
BfaI CTAG 1 cut(s) 218
BfmI CTRYAG 1 cut(s) 258
BisI GCNGC 5 cut(s) 17, 33, 41, 242, 258
BlsI GCNGC 5 cut(s) 18, 34, 42, 243, 259
Bme18I GGWCC 1 cut(s) 203
BmgT120I GGNCC 1 cut(s) 203
BmsI GCATC 3 cut(s) 171, 253, 281
BsaAI YACGTR 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 105
Bse3DI GCAATG 3 cut(s) 35, 72, 99
BseGI GGATG 2 cut(s) 226, 272
BseMI GCAATG 3 cut(s) 35, 72, 99
BseMII CTCAG 2 cut(s) 20, 206
BseNI ACTGG 1 cut(s) 105
BseXI GCAGC 5 cut(s) 19, 28, 52, 228, 244
BshFI GGCC 1 cut(s) 116
BsnI GGCC 1 cut(s) 116
Bsp143I GATC 1 cut(s) 198
BspANI GGCC 1 cut(s) 116
BspCNI CTCAG 2 cut(s) 19, 205
BspMAI CTGCAG 1 cut(s) 262
BsrDI GCAATG 3 cut(s) 35, 72, 99
BsrI ACTGG 1 cut(s) 105
BssMI GATC 1 cut(s) 198
Bst4CI ACNGT 1 cut(s) 156
BstAPI GCANNNNNTGC 1 cut(s) 254
BstBAI YACGTR 1 cut(s) 68
BstC8I GCNNGC 1 cut(s) 246
BstDEI CTNAG 2 cut(s) 6, 192
BstF5I GGATG 2 cut(s) 226, 272
BstKTI GATC 1 cut(s) 201
BstMBI GATC 1 cut(s) 198
BstMWI GCNNNNNNNGC 2 cut(s) 254, 263
BstSFI CTRYAG 1 cut(s) 258
BstV1I GCAGC 5 cut(s) 19, 28, 52, 228, 244
BsuRI GGCC 1 cut(s) 116
BtsCI GGATG 2 cut(s) 226, 272
BtsIMutI CAGTG 1 cut(s) 112
Cac8I GCNNGC 1 cut(s) 246
Cfr13I GGNCC 1 cut(s) 203
Csp6I GTAC 1 cut(s) 69
CviAII CATG 1 cut(s) 49
CviJI RGCY 5 cut(s) 111, 116, 124, 191, 221
CviKI_1 RGCY 5 cut(s) 111, 116, 124, 191, 221
CviQI GTAC 1 cut(s) 69
DdeI CTNAG 2 cut(s) 6, 192
DpnI GATC 1 cut(s) 200
DpnII GATC 1 cut(s) 198
EaeI YGGCCR 1 cut(s) 114
Eco47I GGWCC 1 cut(s) 203
Eco57I CTGAAG 1 cut(s) 121
FaeI CATG 1 cut(s) 52
FaiI YATR 8 cut(s) 14, 50, 59, 128, 167, 172, 188, 282
FalI AAGNNNNNCTT 2 cut(s) 228, 260
FatI CATG 1 cut(s) 48
Fnu4HI GCNGC 5 cut(s) 17, 33, 41, 242, 258
FokI GGATG 2 cut(s) 213, 259
Fsp4HI GCNGC 5 cut(s) 17, 33, 41, 242, 258
FspBI CTAG 1 cut(s) 218
GluI GCNGC 5 cut(s) 17, 33, 41, 242, 258
HaeIII GGCC 1 cut(s) 116
Hin1II CATG 1 cut(s) 52
HinfI GANTC 1 cut(s) 4
Hpy188I TCNGA 1 cut(s) 195
HpyAV CCTTC 1 cut(s) 232
HpyCH4III ACNGT 1 cut(s) 156
HpyCH4IV ACGT 1 cut(s) 67
HpyCH4V TGCA 7 cut(s) 16, 35, 40, 77, 248, 260, 272
HpyF10VI GCNNNNNNNGC 2 cut(s) 254, 263
HpyF3I CTNAG 2 cut(s) 6, 192
HpySE526I ACGT 1 cut(s) 67
Hsp92II CATG 1 cut(s) 52
Kzo9I GATC 1 cut(s) 198
LpnPI CCDG 2 cut(s) 118, 219
Lsp1109I GCAGC 5 cut(s) 19, 28, 52, 228, 244
LweI GCATC 3 cut(s) 171, 253, 281
MaeI CTAG 1 cut(s) 218
MaeII ACGT 1 cut(s) 67
MalI GATC 1 cut(s) 200
MboI GATC 1 cut(s) 198
MboII GAAGA 2 cut(s) 127, 208
MnlI CCTC 3 cut(s) 38, 73, 139
MwoI GCNNNNNNNGC 2 cut(s) 254, 263
NdeII GATC 1 cut(s) 198
NlaIII CATG 1 cut(s) 52
NmeAIII GCCGAG 1 cut(s) 92
PkrI GCNGC 5 cut(s) 18, 34, 42, 243, 259
Ppu21I YACGTR 1 cut(s) 68
PspPI GGNCC 1 cut(s) 203
PstI CTGCAG 1 cut(s) 262
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
SatI GCNGC 5 cut(s) 17, 33, 41, 242, 258
Sau3AI GATC 1 cut(s) 198
Sau96I GGNCC 1 cut(s) 203
SetI ASST 4 cut(s) 30, 65, 70, 126
SfaNI GCATC 3 cut(s) 171, 253, 281
SfcI CTRYAG 1 cut(s) 258
SgeI CNNG 9 cut(s) 41, 61, 78, 117, 124, 218, 230, 248, 257
SinI GGWCC 1 cut(s) 203
SspI AATATT 1 cut(s) 90
SspMI CTAG 1 cut(s) 218
TaaI ACNGT 1 cut(s) 156
TaiI ACGT 1 cut(s) 70
TaqII GACCGA 1 cut(s) 191
TscAI CASTG 1 cut(s) 112
TseI GCWGC 5 cut(s) 16, 32, 40, 241, 257
TspDTI ATGAA 1 cut(s) 65
TspRI CASTG 1 cut(s) 112
VpaK11BI GGWCC 1 cut(s) 203
XspI CTAG 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.