pycom07g26130

E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin- conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
26224204 .. 26224476
273 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g26130.1

Sequence Viewer

Length: 273 bp
ATGGGCGATGAGAATGAGGCCCGGAACTACAGCTACAGCCTAGAGGTTGGAGCGAATGGCAGGAAACTCATATGGGAGGGGACACCACGAAGTGTCCGTGATAGCCACCGAAAGGTCAGGGATAGCCACGATGGTCTCATTATCCAACGAAACATGGCTCTATTCTTCTCCGGAGGCGACAGGAAGGAGCTGAAGCTGAGAGTTACCGGGAGGATATGGAAGGAACAGCAAAATCAAGATTCTGGGGCGTGCATAGCAAACCTGTGTAGCTAA

Protein Analysis

91

Amino Acids

10.24

Weight (kDa)

9.14

Isoelectric Point (pI)

26.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sina_TRAF PF03145 1 - 69 9.8e-23 Sina, TRAF-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 170
AcuI CTGAAG 1 cut(s) 212
AdeI CACNNNGTG 1 cut(s) 92
AfiI CCNNNNNNNGG 1 cut(s) 112
AluBI AGCT 4 cut(s) 33, 190, 196, 270
AluI AGCT 4 cut(s) 33, 190, 196, 270
Alw26I GTCTC 1 cut(s) 140
Aor13HI TCCGGA 1 cut(s) 170
AoxI GGCC 1 cut(s) 18
AspS9I GGNCC 1 cut(s) 19
AsuC2I CCSGG 2 cut(s) 22, 208
BccI CCATC 1 cut(s) 125
BcnI CCSGG 2 cut(s) 22, 208
BcoDI GTCTC 1 cut(s) 140
BfaI CTAG 1 cut(s) 41
BfmI CTRYAG 2 cut(s) 28, 34
Bme1390I CCNGG 2 cut(s) 22, 208
BmgT120I GGNCC 1 cut(s) 19
BmrFI CCNGG 2 cut(s) 22, 208
BpuMI CCSGG 2 cut(s) 22, 208
BsaI GGTCTC 1 cut(s) 140
BsaWI WCCGGW 1 cut(s) 170
Bsc4I CCNNNNNNNGG 1 cut(s) 112
BseAI TCCGGA 1 cut(s) 170
BseLI CCNNNNNNNGG 1 cut(s) 112
BseMII CTCAG 1 cut(s) 188
BshFI GGCC 1 cut(s) 20
BsiSI CCGG 3 cut(s) 22, 171, 207
BslFI GGGAC 1 cut(s) 94
BslI CCNNNNNNNGG 1 cut(s) 112
BsmAI GTCTC 1 cut(s) 140
BsmFI GGGAC 1 cut(s) 94
BsnI GGCC 1 cut(s) 20
Bso31I GGTCTC 1 cut(s) 140
Bsp13I TCCGGA 1 cut(s) 170
BspANI GGCC 1 cut(s) 20
BspCNI CTCAG 1 cut(s) 189
BspEI TCCGGA 1 cut(s) 170
BspTNI GGTCTC 1 cut(s) 140
BstC8I GCNNGC 1 cut(s) 250
BstDEI CTNAG 1 cut(s) 197
BstMAI GTCTC 1 cut(s) 140
BstMWI GCNNNNNNNGC 1 cut(s) 254
BstSCI CCNGG 2 cut(s) 20, 206
BstSFI CTRYAG 2 cut(s) 28, 34
BsuRI GGCC 1 cut(s) 20
BtgZI GCGATG 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 250
Cfr13I GGNCC 1 cut(s) 19
CviAII CATG 1 cut(s) 154
CviJI RGCY 9 cut(s) 20, 33, 39, 105, 126, 158, 190, 196, 270
CviKI_1 RGCY 9 cut(s) 20, 33, 39, 105, 126, 158, 190, 196, 270
DdeI CTNAG 1 cut(s) 197
DraIII CACNNNGTG 1 cut(s) 92
Eco31I GGTCTC 1 cut(s) 140
Eco57I CTGAAG 1 cut(s) 212
FaeI CATG 1 cut(s) 157
FaiI YATR 5 cut(s) 71, 73, 155, 217, 254
FaqI GGGAC 1 cut(s) 94
FatI CATG 1 cut(s) 153
FauNDI CATATG 1 cut(s) 71
FspBI CTAG 1 cut(s) 41
HaeIII GGCC 1 cut(s) 20
HapII CCGG 3 cut(s) 22, 171, 207
Hin1II CATG 1 cut(s) 157
HinfI GANTC 1 cut(s) 239
HpaII CCGG 3 cut(s) 22, 171, 207
Hpy188III TCNNGA 2 cut(s) 171, 236
HpyAV CCTTC 2 cut(s) 178, 214
HpyCH4V TGCA 1 cut(s) 252
HpyF10VI GCNNNNNNNGC 1 cut(s) 254
HpyF3I CTNAG 1 cut(s) 197
Hsp92II CATG 1 cut(s) 157
Kpn2I TCCGGA 1 cut(s) 170
LmnI GCTCC 2 cut(s) 50, 187
LpnPI CCDG 7 cut(s) 35, 46, 103, 166, 184, 220, 228
MaeI CTAG 1 cut(s) 41
MaeIII GTNAC 1 cut(s) 202
MboII GAAGA 1 cut(s) 157
MmeI TCCRAC 2 cut(s) 28, 169
MnlI CCTC 5 cut(s) 10, 37, 70, 167, 204
MroI TCCGGA 1 cut(s) 170
MspI CCGG 3 cut(s) 22, 171, 207
MspR9I CCNGG 2 cut(s) 22, 208
MwoI GCNNNNNNNGC 1 cut(s) 254
NciI CCSGG 2 cut(s) 22, 208
NdeI CATATG 1 cut(s) 71
NlaIII CATG 1 cut(s) 157
PcsI WCGNNNNNNNCGW 1 cut(s) 94
PfeI GAWTC 1 cut(s) 239
PspPI GGNCC 1 cut(s) 19
PsrI GAACNNNNNNTAC 2 cut(s) 17, 49
Sau96I GGNCC 1 cut(s) 19
ScrFI CCNGG 2 cut(s) 22, 208
SetI ASST 7 cut(s) 35, 48, 117, 192, 198, 264, 272
SfcI CTRYAG 2 cut(s) 28, 34
SspMI CTAG 1 cut(s) 41
StyD4I CCNGG 2 cut(s) 20, 206
TfiI GAWTC 1 cut(s) 239
TspGWI ACGGA 1 cut(s) 86
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.