Rmu_sc0021483.1_g000002

E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin- conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021483.1
Physical Location & Seq
Forward (+)
14421 .. 14810
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021483.1_g000002.1.cds

Sequence Viewer

Length: 390 bp
atgaacttcatctgcattccctgtcaggtcttccattgttttggtcaatacttctgcctccattttgaagccttccagcttggcatggctcctgtttatatggcttttctacgttttatgggtgatgagaatgaggcacggaactacagctacagcctcgaggttggagcaaatggcaggaaactcatatgggagggcaccccaagaagtgtccgtgatagccaccggaaggtaagggatagccatgacggtctcattattcaacgaaacatggctttatttttctctggaggagataggaaggagcttaagctgagagttaccgggaggatatggaaggaacagcaaaatccagatgctggagtgtgcataccaaacttatgtagctaa

Protein Analysis

129

Amino Acids

14.9

Weight (kDa)

8.59

Isoelectric Point (pI)

21.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 158
AccB1I GGYRCC 1 cut(s) 197
AccB7I CCANNNNNTGG 1 cut(s) 359
AfiI CCNNNNNNNGG 2 cut(s) 229, 359
AflII CTTAAG 1 cut(s) 308
AgsI TTSAA 2 cut(s) 68, 263
AluBI AGCT 5 cut(s) 79, 150, 307, 313, 387
AluI AGCT 5 cut(s) 79, 150, 307, 313, 387
Alw26I GTCTC 1 cut(s) 257
AlwNI CAGNNNCTG 1 cut(s) 359
Ama87I CYCGRG 1 cut(s) 158
AsuC2I CCSGG 1 cut(s) 325
AsuHPI GGTGA 1 cut(s) 134
AvaI CYCGRG 1 cut(s) 158
BaeGI GKGCMC 1 cut(s) 200
BanI GGYRCC 1 cut(s) 197
BbsI GAAGAC 1 cut(s) 22
BcnI CCSGG 1 cut(s) 325
BcoDI GTCTC 1 cut(s) 257
BfmI CTRYAG 2 cut(s) 145, 151
BfrI CTTAAG 1 cut(s) 308
Bme1390I CCNGG 1 cut(s) 325
BmeT110I CYCGRG 1 cut(s) 158
BmiI GGNNCC 2 cut(s) 90, 199
BmrFI CCNGG 1 cut(s) 325
BmsI GCATC 1 cut(s) 346
BpiI GAAGAC 1 cut(s) 22
BpmI CTGGAG 2 cut(s) 309, 381
BpuMI CCSGG 1 cut(s) 325
BsaI GGTCTC 1 cut(s) 257
BsaWI WCCGGW 1 cut(s) 225
Bsc4I CCNNNNNNNGG 2 cut(s) 229, 359
BseLI CCNNNNNNNGG 2 cut(s) 229, 359
BseMII CTCAG 1 cut(s) 305
BseRI GAGGAG 1 cut(s) 306
BseSI GKGCMC 1 cut(s) 200
BshNI GGYRCC 1 cut(s) 197
BsiHKCI CYCGRG 1 cut(s) 158
BsiSI CCGG 2 cut(s) 226, 324
BslI CCNNNNNNNGG 2 cut(s) 229, 359
BsmAI GTCTC 1 cut(s) 257
BsmI GAATGC 1 cut(s) 15
Bso31I GGTCTC 1 cut(s) 257
BsoBI CYCGRG 1 cut(s) 158
Bsp1286I GDGCHC 1 cut(s) 200
BspCNI CTCAG 1 cut(s) 306
BspLI GGNNCC 2 cut(s) 90, 199
BspT107I GGYRCC 1 cut(s) 197
BspTI CTTAAG 1 cut(s) 308
BspTNI GGTCTC 1 cut(s) 257
Bst4CI ACNGT 1 cut(s) 251
BstAFI CTTAAG 1 cut(s) 308
BstDEI CTNAG 1 cut(s) 314
BstMAI GTCTC 1 cut(s) 257
BstSCI CCNGG 1 cut(s) 323
BstSFI CTRYAG 2 cut(s) 145, 151
BstSLI GKGCMC 1 cut(s) 200
BstV2I GAAGAC 1 cut(s) 22
BstXI CCANNNNNNTGG 1 cut(s) 41
CaiI CAGNNNCTG 1 cut(s) 359
CviAII CATG 3 cut(s) 85, 245, 271
DdeI CTNAG 1 cut(s) 314
Eco31I GGTCTC 1 cut(s) 257
Eco88I CYCGRG 1 cut(s) 158
FaeI CATG 3 cut(s) 88, 248, 274
FatI CATG 3 cut(s) 84, 244, 270
FauNDI CATATG 1 cut(s) 188
GsuI CTGGAG 2 cut(s) 309, 381
HapII CCGG 2 cut(s) 226, 324
Hin1II CATG 3 cut(s) 88, 248, 274
HpaII CCGG 2 cut(s) 226, 324
HphI GGTGA 1 cut(s) 134
Hpy188III TCNNGA 2 cut(s) 288, 353
HpyAV CCTTC 4 cut(s) 82, 223, 295, 331
HpyCH4III ACNGT 1 cut(s) 251
HpyCH4IV ACGT 1 cut(s) 112
HpyCH4V TGCA 2 cut(s) 15, 369
HpyF3I CTNAG 1 cut(s) 314
HpySE526I ACGT 1 cut(s) 112
Hsp92II CATG 3 cut(s) 88, 248, 274
LmnI GCTCC 3 cut(s) 94, 167, 304
LweI GCATC 1 cut(s) 346
MaeII ACGT 1 cut(s) 112
MaeIII GTNAC 1 cut(s) 319
MboII GAAGA 1 cut(s) 22
MhlI GDGCHC 1 cut(s) 200
MmeI TCCRAC 1 cut(s) 145
MnlI CCTC 7 cut(s) 68, 127, 154, 167, 187, 284, 321
MseI TTAA 1 cut(s) 309
MspCI CTTAAG 1 cut(s) 308
MspI CCGG 2 cut(s) 226, 324
MspR9I CCNGG 1 cut(s) 325
Mva1269I GAATGC 1 cut(s) 15
NciI CCSGG 1 cut(s) 325
NdeI CATATG 1 cut(s) 188
NlaIII CATG 3 cut(s) 88, 248, 274
NlaIV GGNNCC 2 cut(s) 90, 199
PaeR7I CTCGAG 1 cut(s) 158
PctI GAATGC 1 cut(s) 15
PflMI CCANNNNNTGG 1 cut(s) 359
PspN4I GGNNCC 2 cut(s) 90, 199
PspXI VCTCGAGB 1 cut(s) 158
PsrI GAACNNNNNNTAC 2 cut(s) 134, 166
PstNI CAGNNNCTG 1 cut(s) 359
SaqAI TTAA 1 cut(s) 309
ScrFI CCNGG 1 cut(s) 325
SduI GDGCHC 1 cut(s) 200
SetI ASST 9 cut(s) 30, 81, 115, 152, 165, 234, 309, 315, 389
SfaNI GCATC 1 cut(s) 346
SfcI CTRYAG 2 cut(s) 145, 151
Sfr274I CTCGAG 1 cut(s) 158
SlaI CTCGAG 1 cut(s) 158
SmlI CTYRAG 2 cut(s) 158, 308
SmoI CTYRAG 2 cut(s) 158, 308
StyD4I CCNGG 1 cut(s) 323
TaaI ACNGT 1 cut(s) 251
TaiI ACGT 1 cut(s) 115
TaqI TCGA 1 cut(s) 159
Tru1I TTAA 1 cut(s) 309
Tru9I TTAA 1 cut(s) 309
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 2 cut(s) 154, 203
Van91I CCANNNNNTGG 1 cut(s) 359
Vha464I CTTAAG 1 cut(s) 308
XhoI CTCGAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.