pycom09g18570

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
19365425 .. 19365763
339 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g18570.2

Sequence Viewer

Length: 264 bp
ATGGAGATGGAAGAGAATGAAAGGAATTTGAGATATGAACTCGAAAATGCACAAACCGCATTGGATGCCAATCGATCTGGTCAATCAGATGAATCCATTGCTGATCCGAAGACGACAGTTGGAACCGAAAATGACGTAGAAGCTTTAAAGAAGGCTATACTTGAAAAATTAGAGGAGAGGAAAAAAGAACTCGTCGGTTTCATTTTTGCTTTCAATCTTACAGTTGTTTCGTCTTCGTTCATTGCAAATGTGTTTGTATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.83

Weight (kDa)

4.53

Isoelectric Point (pI)

34.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 57
AclWI GGATC 1 cut(s) 98
AcsI RAATTY 1 cut(s) 25
AgsI TTSAA 2 cut(s) 164, 214
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
AlwI GGATC 1 cut(s) 98
ApoI RAATTY 1 cut(s) 25
BbsI GAAGAC 2 cut(s) 116, 225
BmiI GGNNCC 1 cut(s) 124
BmsI GCATC 1 cut(s) 55
BpiI GAAGAC 2 cut(s) 116, 225
Bsa29I ATCGAT 1 cut(s) 73
BsaBI GATNNNNATC 1 cut(s) 69
Bse3DI GCAATG 2 cut(s) 96, 240
Bse8I GATNNNNATC 1 cut(s) 69
BseCI ATCGAT 1 cut(s) 73
BseGI GGATG 1 cut(s) 70
BseJI GATNNNNATC 1 cut(s) 69
BseMI GCAATG 2 cut(s) 96, 240
BseRI GAGGAG 1 cut(s) 188
BshVI ATCGAT 1 cut(s) 73
Bsp143I GATC 2 cut(s) 74, 103
BspACI CCGC 1 cut(s) 57
BspDI ATCGAT 1 cut(s) 73
BspLI GGNNCC 1 cut(s) 124
BspPI GGATC 1 cut(s) 98
BsrDI GCAATG 2 cut(s) 96, 240
BssMI GATC 2 cut(s) 74, 103
Bst4CI ACNGT 2 cut(s) 118, 223
Bst6I CTCTTC 1 cut(s) 6
BstAPI GCANNNNNTGC 1 cut(s) 65
BstF5I GGATG 1 cut(s) 70
BstKTI GATC 2 cut(s) 77, 106
BstMBI GATC 2 cut(s) 74, 103
BstMWI GCNNNNNNNGC 2 cut(s) 56, 65
BstV2I GAAGAC 2 cut(s) 116, 225
Bsu15I ATCGAT 1 cut(s) 73
BsuTUI ATCGAT 1 cut(s) 73
BtsCI GGATG 1 cut(s) 70
ClaI ATCGAT 1 cut(s) 73
CviJI RGCY 2 cut(s) 143, 155
CviKI_1 RGCY 2 cut(s) 143, 155
DpnI GATC 2 cut(s) 76, 105
DpnII GATC 2 cut(s) 74, 103
DraI TTTAAA 1 cut(s) 147
Eam1104I CTCTTC 1 cut(s) 6
EarI CTCTTC 1 cut(s) 6
FaiI YATR 2 cut(s) 36, 158
FokI GGATG 1 cut(s) 77
HindIII AAGCTT 1 cut(s) 141
HinfI GANTC 1 cut(s) 92
Hpy188I TCNGA 2 cut(s) 88, 108
Hpy99I CGWCG 1 cut(s) 197
HpyAV CCTTC 1 cut(s) 145
HpyCH4III ACNGT 2 cut(s) 118, 223
HpyCH4IV ACGT 1 cut(s) 135
HpyCH4V TGCA 2 cut(s) 50, 245
HpyF10VI GCNNNNNNNGC 2 cut(s) 56, 65
HpySE526I ACGT 1 cut(s) 135
Kzo9I GATC 2 cut(s) 74, 103
LpnPI CCDG 1 cut(s) 63
LweI GCATC 1 cut(s) 55
MaeII ACGT 1 cut(s) 135
MalI GATC 2 cut(s) 76, 105
MboI GATC 2 cut(s) 74, 103
MboII GAAGA 3 cut(s) 23, 121, 225
MluCI AATT 2 cut(s) 25, 167
MmeI TCCRAC 1 cut(s) 100
MnlI CCTC 2 cut(s) 166, 171
MseI TTAA 1 cut(s) 146
MwoI GCNNNNNNNGC 2 cut(s) 56, 65
NdeII GATC 2 cut(s) 74, 103
NlaIV GGNNCC 1 cut(s) 124
PfeI GAWTC 1 cut(s) 92
PspN4I GGNNCC 1 cut(s) 124
SaqAI TTAA 1 cut(s) 146
Sau3AI GATC 2 cut(s) 74, 103
SetI ASST 2 cut(s) 138, 145
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 4 cut(s) 53, 90, 173, 203
Sse9I AATT 2 cut(s) 25, 167
SsiI CCGC 1 cut(s) 57
TaaI ACNGT 2 cut(s) 118, 223
TaiI ACGT 1 cut(s) 138
TaqI TCGA 2 cut(s) 42, 73
TasI AATT 2 cut(s) 25, 167
TfiI GAWTC 1 cut(s) 92
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
TspDTI ATGAA 5 cut(s) 33, 51, 105, 190, 229
XapI RAATTY 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.