RchiOBHm_Chr2g0163651

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
79046624 .. 79048168
1545 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53178

Sequence Viewer

Length: 357 bp
ATGATTATTGGTATTAGCTGGAAGTGGAGGACTGAACGGAATTTGGGAGATGAACTGGAAAATGCACAAAAGACACTGAATGCCAGTCGATCTCGCAGATCAAATGGCAACTCCAAAACAACTGCTGAAACTGGAGATGACACAGCATCATCGAAGAAAGCTATACTAGACAAGTTAGGGGAGGGGAAAATAGAATTTAGTTCAATGGAAGTAGTAGTTCAAGATTTAGAGAAAAAATGGGGAGAAGTTCAAGATAATGCACTGAGCCAGCCTTTTCCAGGTATCCTACATCATCAAATTTGTTTGCCATATCCTGTGTCCATTTCAATGCATTTAAACATTATGATAACTGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.18

Weight (kDa)

6.28

Isoelectric Point (pI)

52.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 40, 194, 297
AfiI CCNNNNNNNGG 1 cut(s) 278
AgsI TTSAA 4 cut(s) 204, 221, 251, 327
AjnI CCWGG 1 cut(s) 277
AluBI AGCT 2 cut(s) 18, 161
AluI AGCT 2 cut(s) 18, 161
ApoI RAATTY 3 cut(s) 40, 194, 297
BciT130I CCWGG 1 cut(s) 279
BciVI GTATCC 1 cut(s) 293
BfaI CTAG 1 cut(s) 167
BfuI GTATCC 1 cut(s) 293
Bme1390I CCNGG 1 cut(s) 279
BmrFI CCNGG 1 cut(s) 279
BmsI GCATC 1 cut(s) 155
BpmI CTGGAG 1 cut(s) 153
Bsc4I CCNNNNNNNGG 1 cut(s) 278
Bse1I ACTGG 3 cut(s) 60, 84, 136
BseBI CCWGG 1 cut(s) 279
BseLI CCNNNNNNNGG 1 cut(s) 278
BseMII CTCAG 1 cut(s) 254
BseNI ACTGG 3 cut(s) 60, 84, 136
BslI CCNNNNNNNGG 1 cut(s) 278
BsmI GAATGC 1 cut(s) 85
Bsp143I GATC 2 cut(s) 89, 98
BspCNI CTCAG 1 cut(s) 255
BsrI ACTGG 3 cut(s) 60, 84, 136
BssMI GATC 2 cut(s) 89, 98
Bst2UI CCWGG 1 cut(s) 279
Bst4CI ACNGT 1 cut(s) 352
BstC8I GCNNGC 1 cut(s) 269
BstDEI CTNAG 1 cut(s) 263
BstENI CCTNNNNNAGG 1 cut(s) 276
BstKTI GATC 2 cut(s) 92, 101
BstMBI GATC 2 cut(s) 89, 98
BstNI CCWGG 1 cut(s) 279
BstSCI CCNGG 1 cut(s) 277
BsuI GTATCC 1 cut(s) 293
BtsIMutI CAGTG 2 cut(s) 74, 260
Cac8I GCNNGC 1 cut(s) 269
CviJI RGCY 4 cut(s) 18, 161, 267, 271
CviKI_1 RGCY 4 cut(s) 18, 161, 267, 271
DdeI CTNAG 1 cut(s) 263
DpnI GATC 2 cut(s) 91, 100
DpnII GATC 2 cut(s) 89, 98
DraI TTTAAA 1 cut(s) 336
EcoNI CCTNNNNNAGG 1 cut(s) 276
EcoRII CCWGG 1 cut(s) 277
EcoT22I ATGCAT 1 cut(s) 333
FaiI YATR 3 cut(s) 164, 310, 344
FspBI CTAG 1 cut(s) 167
GsuI CTGGAG 1 cut(s) 153
Hpy188III TCNNGA 2 cut(s) 221, 251
HpyCH4III ACNGT 1 cut(s) 352
HpyCH4V TGCA 3 cut(s) 65, 260, 331
HpyF3I CTNAG 1 cut(s) 263
Kzo9I GATC 2 cut(s) 89, 98
LpnPI CCDG 8 cut(s) 4, 41, 97, 117, 264, 281, 291, 327
LweI GCATC 1 cut(s) 155
MaeI CTAG 1 cut(s) 167
MalI GATC 2 cut(s) 91, 100
MboI GATC 2 cut(s) 89, 98
MboII GAAGA 1 cut(s) 166
MluCI AATT 3 cut(s) 40, 194, 297
MnlI CCTC 2 cut(s) 21, 175
Mph1103I ATGCAT 1 cut(s) 333
MseI TTAA 1 cut(s) 335
MslI CAYNNNNRTG 1 cut(s) 326
MspR9I CCNGG 1 cut(s) 279
Mva1269I GAATGC 1 cut(s) 85
MvaI CCWGG 1 cut(s) 279
NdeII GATC 2 cut(s) 89, 98
NsiI ATGCAT 1 cut(s) 333
PctI GAATGC 1 cut(s) 85
Psp6I CCWGG 1 cut(s) 277
PspGI CCWGG 1 cut(s) 277
RseI CAYNNNNRTG 1 cut(s) 326
SaqAI TTAA 1 cut(s) 335
Sau3AI GATC 2 cut(s) 89, 98
ScrFI CCNGG 1 cut(s) 279
SetI ASST 3 cut(s) 20, 163, 283
SfaNI GCATC 1 cut(s) 155
SmiMI CAYNNNNRTG 1 cut(s) 326
Sse9I AATT 3 cut(s) 40, 194, 297
SspMI CTAG 1 cut(s) 167
StyD4I CCNGG 1 cut(s) 277
TaaI ACNGT 1 cut(s) 352
TaqI TCGA 2 cut(s) 88, 152
TasI AATT 3 cut(s) 40, 194, 297
Tru1I TTAA 1 cut(s) 335
Tru9I TTAA 1 cut(s) 335
TscAI CASTG 2 cut(s) 81, 267
TspDTI ATGAA 1 cut(s) 66
TspGWI ACGGA 1 cut(s) 52
TspRI CASTG 2 cut(s) 81, 267
XagI CCTNNNNNAGG 1 cut(s) 276
XapI RAATTY 3 cut(s) 40, 194, 297
XspI CTAG 1 cut(s) 167
Zsp2I ATGCAT 1 cut(s) 333
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.