Rh2AG572100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
80248350 .. 80251665
3316 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG572100.1

Sequence Viewer

Length: 201 bp
ATGGCGACCAAGGAAATGGAGGACACTGAACAGAATTTGGGAGATGAACTGGAAAATGCACAAAAGACACTGAATGCCAGTCAATCTCGCAGATCAGATGGCGACTCCAAAACAACTGCTGAAACTGGAGATGGCATAGCATCATCAAAGAAAGCTATACTAGACAAGTTAGAGGAGGGGAAAATAGATTTCGTTGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.1

Weight (kDa)

4.46

Isoelectric Point (pI)

49.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 34
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
ApoI RAATTY 1 cut(s) 34
BccI CCATC 2 cut(s) 92, 125
BfaI CTAG 1 cut(s) 161
BmsI GCATC 1 cut(s) 149
BpmI CTGGAG 1 cut(s) 147
BsaJI CCNNGG 1 cut(s) 9
Bse1I ACTGG 3 cut(s) 54, 78, 130
BseDI CCNNGG 1 cut(s) 9
BseNI ACTGG 3 cut(s) 54, 78, 130
BseRI GAGGAG 1 cut(s) 188
BsmI GAATGC 1 cut(s) 79
Bsp143I GATC 1 cut(s) 92
BsrI ACTGG 3 cut(s) 54, 78, 130
BssECI CCNNGG 1 cut(s) 9
BssMI GATC 1 cut(s) 92
BssT1I CCWWGG 1 cut(s) 9
BstKTI GATC 1 cut(s) 95
BstMBI GATC 1 cut(s) 92
BstXI CCANNNNNNTGG 1 cut(s) 16
BtsIMutI CAGTG 2 cut(s) 24, 68
CviJI RGCY 1 cut(s) 155
CviKI_1 RGCY 1 cut(s) 155
DpnI GATC 1 cut(s) 94
DpnII GATC 1 cut(s) 92
Eco130I CCWWGG 1 cut(s) 9
EcoT14I CCWWGG 1 cut(s) 9
ErhI CCWWGG 1 cut(s) 9
FaiI YATR 2 cut(s) 137, 158
FspBI CTAG 1 cut(s) 161
GsuI CTGGAG 1 cut(s) 147
HinfI GANTC 1 cut(s) 104
Hpy188I TCNGA 1 cut(s) 97
HpyCH4V TGCA 1 cut(s) 59
Kzo9I GATC 1 cut(s) 92
LpnPI CCDG 3 cut(s) 35, 91, 111
LweI GCATC 1 cut(s) 149
MaeI CTAG 1 cut(s) 161
MalI GATC 1 cut(s) 94
MboI GATC 1 cut(s) 92
MluCI AATT 1 cut(s) 34
MlyI GAGTC 1 cut(s) 98
MnlI CCTC 3 cut(s) 13, 166, 169
Mva1269I GAATGC 1 cut(s) 79
NdeII GATC 1 cut(s) 92
PctI GAATGC 1 cut(s) 79
PleI GAGTC 1 cut(s) 98
PpsI GAGTC 1 cut(s) 98
Sau3AI GATC 1 cut(s) 92
SchI GAGTC 1 cut(s) 98
SetI ASST 1 cut(s) 157
SfaNI GCATC 1 cut(s) 149
SgeI CNNG 7 cut(s) 22, 62, 90, 99, 138, 173, 178
Sse9I AATT 1 cut(s) 34
SspMI CTAG 1 cut(s) 161
StyI CCWWGG 1 cut(s) 9
TasI AATT 1 cut(s) 34
TscAI CASTG 2 cut(s) 31, 75
TspDTI ATGAA 1 cut(s) 60
TspRI CASTG 2 cut(s) 31, 75
XapI RAATTY 1 cut(s) 34
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.