pycom13g06290

Uncharacterized protein K02A2.6-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
4076970 .. 4077284
315 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 315 bp
ATGCGATCCAAATTTATCACAAATATACGAACACCTAGGGCCACCAGCAATTCCAAGAAAAGGAAGATCCAGCAGGCGAGATCGGTTTTCCCGGTTCAAACTGTCGATGCTATACCAGGGCCGATCATCGGCTTTACGGAGCAAGACGCCGAACGAGTAGACTTCTCCCATGACGACGTCCTAGTAATCTATGTCCAATTGGGCATGGTCGGTACAGTGATGGTGGATAATGGCAGCAAAGTCAACATTCTTCAATTTTCCATGATCAAAAGTTGGGCTTCAAGAGCAAAATCAGACGCCGGAAGGAGGTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.6

Weight (kDa)

10.41

Isoelectric Point (pI)

41.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 180
AccI GTMKAC 1 cut(s) 159
AclWI GGATC 1 cut(s) 61
AcsI RAATTY 1 cut(s) 11
AcyI GRCGYC 3 cut(s) 147, 177, 297
AfaI GTAC 1 cut(s) 214
AfiI CCNNNNNNNGG 3 cut(s) 60, 128, 306
AgsI TTSAA 3 cut(s) 98, 254, 282
AjnI CCWGG 1 cut(s) 115
AlwI GGATC 1 cut(s) 61
AoxI GGCC 2 cut(s) 39, 119
ApeKI GCWGC 1 cut(s) 234
ApoI RAATTY 1 cut(s) 11
AspA2I CCTAGG 1 cut(s) 35
AspS9I GGNCC 2 cut(s) 39, 119
AsuC2I CCSGG 1 cut(s) 92
AvrII CCTAGG 1 cut(s) 35
BbvI GCAGC 1 cut(s) 246
BccI CCATC 1 cut(s) 214
BciT130I CCWGG 1 cut(s) 117
BclI TGATCA 1 cut(s) 264
BcnI CCSGG 1 cut(s) 92
BfaI CTAG 2 cut(s) 36, 182
BisI GCNGC 1 cut(s) 235
BlnI CCTAGG 1 cut(s) 35
BlsI GCNGC 1 cut(s) 236
Bme1390I CCNGG 2 cut(s) 92, 117
BmgT120I GGNCC 2 cut(s) 39, 119
BmrFI CCNGG 2 cut(s) 92, 117
BmsI GCATC 1 cut(s) 97
BpuMI CCSGG 1 cut(s) 92
BsaHI GRCGYC 3 cut(s) 147, 177, 297
BsaJI CCNNGG 2 cut(s) 35, 116
Bsc4I CCNNNNNNNGG 3 cut(s) 60, 128, 306
BseBI CCWGG 1 cut(s) 117
BseDI CCNNGG 2 cut(s) 35, 116
BseLI CCNNNNNNNGG 3 cut(s) 60, 128, 306
BseXI GCAGC 1 cut(s) 246
BshFI GGCC 2 cut(s) 41, 121
BsiSI CCGG 2 cut(s) 92, 300
BslI CCNNNNNNNGG 3 cut(s) 60, 128, 306
BsnI GGCC 2 cut(s) 41, 121
Bsp143I GATC 5 cut(s) 5, 66, 80, 123, 264
BspANI GGCC 2 cut(s) 41, 121
BspPI GGATC 1 cut(s) 61
BssECI CCNNGG 2 cut(s) 35, 116
BssMI GATC 5 cut(s) 5, 66, 80, 123, 264
BssNI GRCGYC 3 cut(s) 147, 177, 297
BssT1I CCWWGG 1 cut(s) 35
Bst2UI CCWGG 1 cut(s) 117
Bst4CI ACNGT 2 cut(s) 103, 217
BstACI GRCGYC 3 cut(s) 147, 177, 297
BstC8I GCNNGC 1 cut(s) 75
BstKTI GATC 5 cut(s) 8, 69, 83, 126, 267
BstMBI GATC 5 cut(s) 5, 66, 80, 123, 264
BstMWI GCNNNNNNNGC 1 cut(s) 284
BstNI CCWGG 1 cut(s) 117
BstSCI CCNGG 2 cut(s) 90, 115
BstV1I GCAGC 1 cut(s) 246
BstX2I RGATCY 1 cut(s) 66
BstYI RGATCY 1 cut(s) 66
BsuRI GGCC 2 cut(s) 41, 121
BtsIMutI CAGTG 1 cut(s) 222
Cac8I GCNNGC 1 cut(s) 75
Cfr13I GGNCC 2 cut(s) 39, 119
CseI GACGC 2 cut(s) 155, 305
Csp6I GTAC 1 cut(s) 213
CviAII CATG 3 cut(s) 170, 205, 262
CviJI RGCY 4 cut(s) 41, 121, 132, 278
CviKI_1 RGCY 4 cut(s) 41, 121, 132, 278
CviQI GTAC 1 cut(s) 213
DpnI GATC 5 cut(s) 7, 68, 82, 125, 266
DpnII GATC 5 cut(s) 5, 66, 80, 123, 264
Eco130I CCWWGG 1 cut(s) 35
EcoRII CCWGG 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 35
ErhI CCWWGG 1 cut(s) 35
FaeI CATG 3 cut(s) 173, 208, 265
FaiI YATR 6 cut(s) 26, 113, 171, 192, 206, 263
FalI AAGNNNNNCTT 3 cut(s) 262, 294, 295
FatI CATG 3 cut(s) 169, 204, 261
FbaI TGATCA 1 cut(s) 264
FblI GTMKAC 1 cut(s) 159
Fnu4HI GCNGC 1 cut(s) 235
Fsp4HI GCNGC 1 cut(s) 235
FspBI CTAG 2 cut(s) 36, 182
GluI GCNGC 1 cut(s) 235
HaeIII GGCC 2 cut(s) 41, 121
HapII CCGG 2 cut(s) 92, 300
HgaI GACGC 2 cut(s) 155, 305
Hin1I GRCGYC 3 cut(s) 147, 177, 297
Hin1II CATG 3 cut(s) 173, 208, 265
HincII GTYRAC 1 cut(s) 244
HindII GTYRAC 1 cut(s) 244
HpaII CCGG 2 cut(s) 92, 300
Hpy166II GTNNAC 2 cut(s) 160, 244
Hpy188I TCNGA 1 cut(s) 295
Hpy188III TCNNGA 2 cut(s) 282, 312
Hpy8I GTNNAC 2 cut(s) 160, 244
Hpy99I CGWCG 1 cut(s) 179
HpyAV CCTTC 1 cut(s) 297
HpyCH4III ACNGT 2 cut(s) 103, 217
HpyCH4IV ACGT 1 cut(s) 177
HpyF10VI GCNNNNNNNGC 1 cut(s) 284
HpySE526I ACGT 1 cut(s) 177
Hsp92I GRCGYC 3 cut(s) 147, 177, 297
Hsp92II CATG 3 cut(s) 173, 208, 265
Ksp22I TGATCA 1 cut(s) 264
Kzo9I GATC 5 cut(s) 5, 66, 80, 123, 264
LmnI GCTCC 1 cut(s) 139
LpnPI CCDG 6 cut(s) 58, 59, 83, 102, 105, 129
Lsp1109I GCAGC 1 cut(s) 246
LweI GCATC 1 cut(s) 97
MaeI CTAG 2 cut(s) 36, 182
MaeII ACGT 1 cut(s) 177
MalI GATC 5 cut(s) 7, 68, 82, 125, 266
MboI GATC 5 cut(s) 5, 66, 80, 123, 264
MboII GAAGA 2 cut(s) 76, 242
MfeI CAATTG 1 cut(s) 197
MflI RGATCY 1 cut(s) 66
MluCI AATT 4 cut(s) 11, 49, 197, 254
MnlI CCTC 1 cut(s) 300
MspI CCGG 2 cut(s) 92, 300
MspR9I CCNGG 2 cut(s) 92, 117
MunI CAATTG 1 cut(s) 197
MvaI CCWGG 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 284
NciI CCSGG 1 cut(s) 92
NdeII GATC 5 cut(s) 5, 66, 80, 123, 264
NlaIII CATG 3 cut(s) 173, 208, 265
PflFI GACNNNGTC 1 cut(s) 176
PkrI GCNGC 1 cut(s) 236
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
PspPI GGNCC 2 cut(s) 39, 119
PsuI RGATCY 1 cut(s) 66
PsyI GACNNNGTC 1 cut(s) 176
RsaI GTAC 1 cut(s) 214
RsaNI GTAC 1 cut(s) 213
SatI GCNGC 1 cut(s) 235
Sau3AI GATC 5 cut(s) 5, 66, 80, 123, 264
Sau96I GGNCC 2 cut(s) 39, 119
ScrFI CCNGG 2 cut(s) 92, 117
SetI ASST 3 cut(s) 37, 180, 311
SfaNI GCATC 1 cut(s) 97
Sse9I AATT 4 cut(s) 11, 49, 197, 254
SspMI CTAG 2 cut(s) 36, 182
StyD4I CCNGG 2 cut(s) 90, 115
StyI CCWWGG 1 cut(s) 35
TaaI ACNGT 2 cut(s) 103, 217
TaiI ACGT 1 cut(s) 180
TaqI TCGA 1 cut(s) 105
TasI AATT 4 cut(s) 11, 49, 197, 254
TscAI CASTG 1 cut(s) 222
TseI GCWGC 1 cut(s) 234
TspGWI ACGGA 1 cut(s) 152
TspRI CASTG 1 cut(s) 222
Tth111I GACNNNGTC 1 cut(s) 176
XapI RAATTY 1 cut(s) 11
XmaJI CCTAGG 1 cut(s) 35
XmiI GTMKAC 1 cut(s) 159
XspI CTAG 2 cut(s) 36, 182
ZraI GACGTC 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.