pycom15g34450

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
34186000 .. 34186305
306 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g34450.1

Sequence Viewer

Length: 306 bp
ATGCAGACGAGACGGGACGGAACGGAATGGGACGGGACGGGACGGGACAGGATGGGACGGAACGGAGCGGGAGCAAAGATGCCCTCGGATGGAAACAAGGAGGAAGAAGAAGGAGACAGAGAGGTTATAATTTTGTGTTCCACGGATGTGGAACGAGTCGTTCCAGGGGGTGAGGTGGAACGAAAATTCACCCAAAACTCGTCCCGTGGAACAACTCGTTCCACCCGTTTTAGGCGCACCAAACGTGGGACGGAACGCCTTGTCCCACTCTGTTCCGTCCCATCCCACGTACCAAATGGTACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.24

Weight (kDa)

9.29

Isoelectric Point (pI)

54.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 128
Acc65I GGTACC 1 cut(s) 299
AccB1I GGYRCC 1 cut(s) 299
AccBSI CCGCTC 1 cut(s) 68
AciI CCGC 1 cut(s) 68
AcsI RAATTY 1 cut(s) 185
AfaI GTAC 2 cut(s) 291, 301
AfiI CCNNNNNNNGG 3 cut(s) 89, 231, 246
AjnI CCWGG 1 cut(s) 163
AleI CACNNNNGTG 1 cut(s) 146
AloI GAACNNNNNNTCC 2 cut(s) 246, 278
Alw26I GTCTC 2 cut(s) 4, 108
ApoI RAATTY 1 cut(s) 185
Asp718I GGTACC 1 cut(s) 299
AspLEI GCGC 1 cut(s) 237
AsuHPI GGTGA 2 cut(s) 181, 182
BanI GGYRCC 1 cut(s) 299
BccI CCATC 3 cut(s) 46, 83, 289
BciT130I CCWGG 1 cut(s) 165
BcoDI GTCTC 2 cut(s) 4, 108
Bme1390I CCNGG 1 cut(s) 165
BmiI GGNNCC 1 cut(s) 301
BmrFI CCNGG 1 cut(s) 165
BmsI GCATC 1 cut(s) 69
BsaAI YACGTR 1 cut(s) 289
BsaJI CCNNGG 4 cut(s) 84, 141, 164, 205
Bsc4I CCNNNNNNNGG 3 cut(s) 89, 231, 246
BseBI CCWGG 1 cut(s) 165
BseDI CCNNGG 4 cut(s) 84, 141, 164, 205
BseGI GGATG 4 cut(s) 57, 94, 151, 281
BseLI CCNNNNNNNGG 3 cut(s) 89, 231, 246
BshNI GGYRCC 1 cut(s) 299
BslI CCNNNNNNNGG 3 cut(s) 89, 231, 246
BsmAI GTCTC 2 cut(s) 4, 108
BsmBI CGTCTC 1 cut(s) 4
BspACI CCGC 1 cut(s) 68
BspLI GGNNCC 1 cut(s) 301
BspT107I GGYRCC 1 cut(s) 299
BsrBI CCGCTC 1 cut(s) 68
BssECI CCNNGG 4 cut(s) 84, 141, 164, 205
Bst2UI CCWGG 1 cut(s) 165
BstBAI YACGTR 1 cut(s) 289
BstDSI CCRYGG 2 cut(s) 141, 205
BstF5I GGATG 4 cut(s) 57, 94, 151, 281
BstHHI GCGC 1 cut(s) 237
BstMAI GTCTC 2 cut(s) 4, 108
BstNI CCWGG 1 cut(s) 165
BstSCI CCNGG 1 cut(s) 163
BstXI CCANNNNNNTGG 1 cut(s) 148
BtgI CCRYGG 2 cut(s) 141, 205
BtsCI GGATG 4 cut(s) 57, 94, 151, 281
CfoI GCGC 1 cut(s) 237
Csp6I GTAC 2 cut(s) 290, 300
CviQI GTAC 2 cut(s) 290, 300
EcoRII CCWGG 1 cut(s) 163
Esp3I CGTCTC 1 cut(s) 4
FaiI YATR 1 cut(s) 128
FauI CCCGC 1 cut(s) 61
FokI GGATG 4 cut(s) 64, 101, 158, 268
GlaI GCGC 1 cut(s) 236
HhaI GCGC 1 cut(s) 237
Hin6I GCGC 1 cut(s) 235
HinP1I GCGC 1 cut(s) 235
HinfI GANTC 1 cut(s) 156
HphI GGTGA 2 cut(s) 181, 182
Hpy188I TCNGA 1 cut(s) 88
HpyAV CCTTC 1 cut(s) 104
HpyCH4IV ACGT 2 cut(s) 244, 288
HpyCH4V TGCA 1 cut(s) 4
HpySE526I ACGT 2 cut(s) 244, 288
HspAI GCGC 1 cut(s) 235
KpnI GGTACC 1 cut(s) 303
LmnI GCTCC 2 cut(s) 65, 71
LpnPI CCDG 3 cut(s) 34, 150, 177
LweI GCATC 1 cut(s) 69
MaeII ACGT 2 cut(s) 244, 288
MbiI CCGCTC 1 cut(s) 68
MboII GAAGA 2 cut(s) 116, 119
MluCI AATT 2 cut(s) 129, 185
MlyI GAGTC 1 cut(s) 165
MnlI CCTC 4 cut(s) 94, 94, 115, 166
MslI CAYNNNNRTG 1 cut(s) 146
MspR9I CCNGG 1 cut(s) 165
MvaI CCWGG 1 cut(s) 165
NlaIV GGNNCC 1 cut(s) 301
OliI CACNNNNGTG 1 cut(s) 146
PcsI WCGNNNNNNNCGW 1 cut(s) 223
PleI GAGTC 1 cut(s) 164
PpsI GAGTC 1 cut(s) 164
Ppu21I YACGTR 1 cut(s) 289
PsiI TTATAA 1 cut(s) 128
Psp6I CCWGG 1 cut(s) 163
PspGI CCWGG 1 cut(s) 163
PspN4I GGNNCC 1 cut(s) 301
RsaI GTAC 2 cut(s) 291, 301
RsaNI GTAC 2 cut(s) 290, 300
RseI CAYNNNNRTG 1 cut(s) 146
SchI GAGTC 1 cut(s) 165
ScrFI CCNGG 1 cut(s) 165
SetI ASST 5 cut(s) 126, 177, 247, 291, 305
SfaNI GCATC 1 cut(s) 69
SmiMI CAYNNNNRTG 1 cut(s) 146
Sse9I AATT 2 cut(s) 129, 185
SsiI CCGC 1 cut(s) 68
StyD4I CCNGG 1 cut(s) 163
TaiI ACGT 2 cut(s) 247, 291
TasI AATT 2 cut(s) 129, 185
TspGWI ACGGA 7 cut(s) 33, 38, 73, 78, 158, 265, 266
XapI RAATTY 1 cut(s) 185
XcmI CCANNNNNNNNNTGG 1 cut(s) 293
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.