Rw7G031910

Sar1p-like members of the Ras-family of small GTPases

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Forward (+)
45961902 .. 45962667
766 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G031910.1

Sequence Viewer

Length: 234 bp
ATGTTTCTGTTTGCTTGGTTGTACGGTGTGCTCGCTTCCCTCGGTCTGTGGCAGAAGGAGGCCAAGATCTTATTCCTAGCGCTCAATAATGCTGGCAAGACCACCTTGCTTCACATGCTCAAAGATGAGGAGTTGAGAATTGGCAAAATCAAGTTCAAGGCCTTTGATTTGGGAGGTCATCAGATTATAGATGCTGTGGTGTACCTTGTGGATGCCTACGATGGTTTTAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.73

Weight (kDa)

8.0

Isoelectric Point (pI)

15.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 9 - 63 2.4e-09 ADP-ribosylation factor family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 23, 203
AfeI AGCGCT 1 cut(s) 81
AgsI TTSAA 1 cut(s) 157
AjuI GAANNNNNNNTTGG 2 cut(s) 56, 88
Alw21I GWGCWC 1 cut(s) 33
Aor51HI AGCGCT 1 cut(s) 81
AoxI GGCC 2 cut(s) 60, 159
AspLEI GCGC 1 cut(s) 82
Bbv12I GWGCWC 1 cut(s) 33
BccI CCATC 1 cut(s) 215
BfaI CTAG 1 cut(s) 77
BfoI RGCGCY 1 cut(s) 83
BglII AGATCT 1 cut(s) 66
BmsI GCATC 2 cut(s) 181, 202
BsaJI CCNNGG 1 cut(s) 40
BseDI CCNNGG 1 cut(s) 40
BseGI GGATG 1 cut(s) 217
BseRI GAGGAG 1 cut(s) 143
BshFI GGCC 2 cut(s) 62, 161
BsiHKAI GWGCWC 1 cut(s) 33
BsnI GGCC 2 cut(s) 62, 161
Bsp1286I GDGCHC 1 cut(s) 33
Bsp143I GATC 1 cut(s) 66
BspANI GGCC 2 cut(s) 62, 161
BssECI CCNNGG 1 cut(s) 40
BssMI GATC 1 cut(s) 66
Bst4CI ACNGT 1 cut(s) 26
BstC8I GCNNGC 2 cut(s) 33, 94
BstF5I GGATG 1 cut(s) 217
BstH2I RGCGCY 1 cut(s) 83
BstHHI GCGC 1 cut(s) 82
BstKTI GATC 1 cut(s) 69
BstMBI GATC 1 cut(s) 66
BstMWI GCNNNNNNNGC 1 cut(s) 115
BstNSI RCATGY 1 cut(s) 118
BstX2I RGATCY 1 cut(s) 66
BstYI RGATCY 1 cut(s) 66
BsuRI GGCC 2 cut(s) 62, 161
BtsCI GGATG 1 cut(s) 217
Cac8I GCNNGC 2 cut(s) 33, 94
CfoI GCGC 1 cut(s) 82
Csp6I GTAC 2 cut(s) 22, 202
CviAII CATG 1 cut(s) 115
CviJI RGCY 2 cut(s) 62, 161
CviKI_1 RGCY 2 cut(s) 62, 161
CviQI GTAC 2 cut(s) 22, 202
DpnI GATC 1 cut(s) 68
DpnII GATC 1 cut(s) 66
DraI TTTAAA 1 cut(s) 229
Eco147I AGGCCT 1 cut(s) 161
Eco47III AGCGCT 1 cut(s) 81
FaeI CATG 1 cut(s) 118
FaiI YATR 2 cut(s) 116, 188
FalI AAGNNNNNCTT 2 cut(s) 89, 121
FatI CATG 1 cut(s) 114
FokI GGATG 1 cut(s) 224
FspBI CTAG 1 cut(s) 77
GlaI GCGC 1 cut(s) 81
HaeII RGCGCY 1 cut(s) 83
HaeIII GGCC 2 cut(s) 62, 161
HhaI GCGC 1 cut(s) 82
Hin1II CATG 1 cut(s) 118
Hin6I GCGC 1 cut(s) 80
HinP1I GCGC 1 cut(s) 80
Hpy166II GTNNAC 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 183
Hpy8I GTNNAC 1 cut(s) 202
HpyAV CCTTC 1 cut(s) 49
HpyCH4III ACNGT 1 cut(s) 26
HpyF10VI GCNNNNNNNGC 1 cut(s) 115
Hsp92II CATG 1 cut(s) 118
HspAI GCGC 1 cut(s) 80
Kzo9I GATC 1 cut(s) 66
LpnPI CCDG 1 cut(s) 78
LweI GCATC 2 cut(s) 181, 202
MaeI CTAG 1 cut(s) 77
MalI GATC 1 cut(s) 68
MboI GATC 1 cut(s) 66
MflI RGATCY 1 cut(s) 66
MhlI GDGCHC 1 cut(s) 33
MluCI AATT 1 cut(s) 138
MnlI CCTC 4 cut(s) 50, 52, 121, 167
MseI TTAA 1 cut(s) 228
MwoI GCNNNNNNNGC 1 cut(s) 115
NdeII GATC 1 cut(s) 66
NlaIII CATG 1 cut(s) 118
NspI RCATGY 1 cut(s) 118
PceI AGGCCT 1 cut(s) 161
PsuI RGATCY 1 cut(s) 66
RsaI GTAC 2 cut(s) 23, 203
RsaNI GTAC 2 cut(s) 22, 202
SaqAI TTAA 1 cut(s) 228
Sau3AI GATC 1 cut(s) 66
SduI GDGCHC 1 cut(s) 33
SetI ASST 3 cut(s) 107, 178, 207
SfaNI GCATC 2 cut(s) 181, 202
Sse9I AATT 1 cut(s) 138
SseBI AGGCCT 1 cut(s) 161
SspMI CTAG 1 cut(s) 77
StuI AGGCCT 1 cut(s) 161
TaaI ACNGT 1 cut(s) 26
TaqII GACCGA 1 cut(s) 32
TasI AATT 1 cut(s) 138
Tru1I TTAA 1 cut(s) 228
Tru9I TTAA 1 cut(s) 228
XceI RCATGY 1 cut(s) 118
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.