Rmu_sc0033404.1_g000001
ERF Family

Belongs to the small GTPase superfamily. SAR1 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033404.1
Physical Location & Seq
Forward (+)
1 .. 346
346 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033404.1_g000001.1.cds

Sequence Viewer

Length: 241 bp
tctggcatccctagggctgtggcagaaggaagctaagatcttgttcttggggctcgataatgccgggaagaccaccttgctccacatgctcaaagatgagagattagttcagcaccaaccgactcagtacccgacctccgaggagttgagtatagggaagattaagttcaaggcttttgatttgggtggccatcagatcgctcgcagagtctggaaggattattacgccaaggttttttaa

Protein Analysis

79

Amino Acids

9.1

Weight (kDa)

9.52

Isoelectric Point (pI)

29.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 188
AfaI GTAC 1 cut(s) 129
AgsI TTSAA 1 cut(s) 170
AluBI AGCT 1 cut(s) 33
AluI AGCT 1 cut(s) 33
AlwNI CAGNNNCTG 1 cut(s) 211
AoxI GGCC 1 cut(s) 188
AspA2I CCTAGG 1 cut(s) 11
AsuC2I CCSGG 1 cut(s) 65
AvrII CCTAGG 1 cut(s) 11
BalI TGGCCA 1 cut(s) 190
BanII GRGCYC 1 cut(s) 55
BarI GAAGNNNNNNTAC 2 cut(s) 207, 239
BbsI GAAGAC 1 cut(s) 75
BccI CCATC 1 cut(s) 199
BcnI CCSGG 1 cut(s) 65
BfaI CTAG 1 cut(s) 12
BglII AGATCT 1 cut(s) 37
BlnI CCTAGG 1 cut(s) 11
Bme1390I CCNGG 1 cut(s) 65
BmrFI CCNGG 1 cut(s) 65
BmsI GCATC 1 cut(s) 15
BpiI GAAGAC 1 cut(s) 75
BpuMI CCSGG 1 cut(s) 65
BsaJI CCNNGG 3 cut(s) 11, 139, 229
BsaXI ACNNNNNCTCC 2 cut(s) 120, 150
BseDI CCNNGG 3 cut(s) 11, 139, 229
BseGI GGATG 1 cut(s) 6
BseMII CTCAG 1 cut(s) 138
BseRI GAGGAG 1 cut(s) 156
BshFI GGCC 1 cut(s) 190
BsiSI CCGG 1 cut(s) 64
BsnI GGCC 1 cut(s) 190
Bsp1286I GDGCHC 1 cut(s) 55
Bsp143I GATC 2 cut(s) 37, 196
BspANI GGCC 1 cut(s) 190
BspCNI CTCAG 1 cut(s) 137
BssECI CCNNGG 3 cut(s) 11, 139, 229
BssMI GATC 2 cut(s) 37, 196
BssT1I CCWWGG 2 cut(s) 11, 229
BstC8I GCNNGC 1 cut(s) 203
BstDEI CTNAG 2 cut(s) 34, 124
BstF5I GGATG 1 cut(s) 6
BstKTI GATC 2 cut(s) 40, 199
BstMBI GATC 2 cut(s) 37, 196
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstNSI RCATGY 1 cut(s) 89
BstSCI CCNGG 1 cut(s) 63
BstV2I GAAGAC 1 cut(s) 75
BstX2I RGATCY 1 cut(s) 37
BstYI RGATCY 1 cut(s) 37
BsuRI GGCC 1 cut(s) 190
BtsCI GGATG 1 cut(s) 6
Cac8I GCNNGC 1 cut(s) 203
CaiI CAGNNNCTG 1 cut(s) 211
Csp6I GTAC 1 cut(s) 128
CviAII CATG 1 cut(s) 86
CviJI RGCY 5 cut(s) 17, 33, 53, 174, 190
CviKI_1 RGCY 5 cut(s) 17, 33, 53, 174, 190
CviQI GTAC 1 cut(s) 128
DdeI CTNAG 2 cut(s) 34, 124
DpnI GATC 2 cut(s) 39, 198
DpnII GATC 2 cut(s) 37, 196
EaeI YGGCCR 1 cut(s) 188
Eco130I CCWWGG 2 cut(s) 11, 229
Eco24I GRGCYC 1 cut(s) 55
EcoT14I CCWWGG 2 cut(s) 11, 229
EcoT38I GRGCYC 1 cut(s) 55
ErhI CCWWGG 2 cut(s) 11, 229
FaeI CATG 1 cut(s) 89
FaiI YATR 2 cut(s) 87, 153
FalI AAGNNNNNCTT 2 cut(s) 60, 92
FatI CATG 1 cut(s) 85
FriOI GRGCYC 1 cut(s) 55
FspBI CTAG 1 cut(s) 12
HaeIII GGCC 1 cut(s) 190
HapII CCGG 1 cut(s) 64
Hin1II CATG 1 cut(s) 89
HinfI GANTC 2 cut(s) 122, 208
HpaII CCGG 1 cut(s) 64
Hpy188I TCNGA 2 cut(s) 140, 196
Hpy188III TCNNGA 1 cut(s) 212
HpyAV CCTTC 2 cut(s) 20, 209
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 2 cut(s) 34, 124
Hsp92II CATG 1 cut(s) 89
Kzo9I GATC 2 cut(s) 37, 196
LmnI GCTCC 1 cut(s) 85
LpnPI CCDG 2 cut(s) 77, 197
LweI GCATC 1 cut(s) 15
MaeI CTAG 1 cut(s) 12
MalI GATC 2 cut(s) 39, 198
MboI GATC 2 cut(s) 37, 196
MboII GAAGA 2 cut(s) 80, 170
MflI RGATCY 1 cut(s) 37
MhlI GDGCHC 1 cut(s) 55
MlsI TGGCCA 1 cut(s) 190
MluNI TGGCCA 1 cut(s) 190
MlyI GAGTC 2 cut(s) 116, 217
MnlI CCTC 2 cut(s) 134, 146
Mox20I TGGCCA 1 cut(s) 190
MscI TGGCCA 1 cut(s) 190
MseI TTAA 2 cut(s) 163, 239
Msp20I TGGCCA 1 cut(s) 190
MspI CCGG 1 cut(s) 64
MspR9I CCNGG 1 cut(s) 65
MwoI GCNNNNNNNGC 1 cut(s) 86
NciI CCSGG 1 cut(s) 65
NdeII GATC 2 cut(s) 37, 196
NlaIII CATG 1 cut(s) 89
NspI RCATGY 1 cut(s) 89
PleI GAGTC 2 cut(s) 116, 216
PpsI GAGTC 2 cut(s) 116, 216
PstNI CAGNNNCTG 1 cut(s) 211
PsuI RGATCY 1 cut(s) 37
RsaI GTAC 1 cut(s) 129
RsaNI GTAC 1 cut(s) 128
SaqAI TTAA 2 cut(s) 163, 239
Sau3AI GATC 2 cut(s) 37, 196
SchI GAGTC 2 cut(s) 116, 217
ScrFI CCNGG 1 cut(s) 65
SduI GDGCHC 1 cut(s) 55
SetI ASST 4 cut(s) 35, 78, 138, 235
SfaNI GCATC 1 cut(s) 15
SspMI CTAG 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 63
StyI CCWWGG 2 cut(s) 11, 229
TaqI TCGA 1 cut(s) 55
Tru1I TTAA 2 cut(s) 163, 239
Tru9I TTAA 2 cut(s) 163, 239
XceI RCATGY 1 cut(s) 89
XmaJI CCTAGG 1 cut(s) 11
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.