Rh5CG358500
ERF Family

Belongs to the small GTPase superfamily. SAR1 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
42390994 .. 42391996
1003 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG358500.1

Sequence Viewer

Length: 204 bp
ATGTTTTTCTTCGACTGGTTCTACGGCGTGCTTGCTTCCCTCGGTCTGTGGCAGAAGGAGGCCAAGGTCTTGTTCCTCGGGCTCGATAATGCCGGCAAGACCTTGCTTCACATGCTCAAAGATGAGGGCTGTTCATTAGTCTTCGAAAACACAAGAACCTACTCTCCAGCAACTAAGGTTGTTTATGAATACAAATGGCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.83

Weight (kDa)

6.53

Isoelectric Point (pI)

21.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 8 - 44 2.5e-08 ADP-ribosylation factor family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjuI GAANNNNNNNTTGG 2 cut(s) 56, 88
AloI GAACNNNNNNTCC 2 cut(s) 148, 180
Ama87I CYCGRG 1 cut(s) 77
AoxI GGCC 1 cut(s) 60
AsuII TTCGAA 1 cut(s) 144
AvaI CYCGRG 1 cut(s) 77
BanII GRGCYC 1 cut(s) 84
BbsI GAAGAC 1 cut(s) 133
BceAI ACGGC 1 cut(s) 40
BfmI CTRYAG 1 cut(s) 200
BmeT110I CYCGRG 1 cut(s) 77
BpiI GAAGAC 1 cut(s) 133
BpmI CTGGAG 1 cut(s) 150
Bpu14I TTCGAA 1 cut(s) 144
BsaJI CCNNGG 3 cut(s) 40, 63, 76
BsaXI ACNNNNNCTCC 2 cut(s) 148, 178
Bse118I RCCGGY 1 cut(s) 92
Bse1I ACTGG 1 cut(s) 20
BseDI CCNNGG 3 cut(s) 40, 63, 76
BseNI ACTGG 1 cut(s) 20
BshFI GGCC 1 cut(s) 62
BsiHKCI CYCGRG 1 cut(s) 77
BsiSI CCGG 1 cut(s) 93
BsnI GGCC 1 cut(s) 62
BsoBI CYCGRG 1 cut(s) 77
Bsp119I TTCGAA 1 cut(s) 144
Bsp1286I GDGCHC 1 cut(s) 84
BspANI GGCC 1 cut(s) 62
BspT104I TTCGAA 1 cut(s) 144
BsrFI RCCGGY 1 cut(s) 92
BsrI ACTGG 1 cut(s) 20
BssAI RCCGGY 1 cut(s) 92
BssECI CCNNGG 3 cut(s) 40, 63, 76
BssT1I CCWWGG 1 cut(s) 63
BstBI TTCGAA 1 cut(s) 144
BstC8I GCNNGC 3 cut(s) 29, 33, 94
BstDEI CTNAG 1 cut(s) 174
BstMWI GCNNNNNNNGC 1 cut(s) 112
BstNSI RCATGY 1 cut(s) 115
BstSFI CTRYAG 1 cut(s) 200
BstV2I GAAGAC 1 cut(s) 133
BsuRI GGCC 1 cut(s) 62
Cac8I GCNNGC 3 cut(s) 29, 33, 94
Cfr10I RCCGGY 1 cut(s) 92
CviAII CATG 1 cut(s) 112
CviJI RGCY 4 cut(s) 62, 82, 129, 199
CviKI_1 RGCY 4 cut(s) 62, 82, 129, 199
DdeI CTNAG 1 cut(s) 174
Eco130I CCWWGG 1 cut(s) 63
Eco24I GRGCYC 1 cut(s) 84
Eco88I CYCGRG 1 cut(s) 77
EcoT14I CCWWGG 1 cut(s) 63
EcoT38I GRGCYC 1 cut(s) 84
ErhI CCWWGG 1 cut(s) 63
FaeI CATG 1 cut(s) 115
FaiI YATR 3 cut(s) 113, 186, 202
FatI CATG 1 cut(s) 111
FriOI GRGCYC 1 cut(s) 84
GsuI CTGGAG 1 cut(s) 150
HaeIII GGCC 1 cut(s) 62
HapII CCGG 1 cut(s) 93
Hin1II CATG 1 cut(s) 115
HpaII CCGG 1 cut(s) 93
HpyAV CCTTC 1 cut(s) 49
HpyF10VI GCNNNNNNNGC 1 cut(s) 112
HpyF3I CTNAG 1 cut(s) 174
Hsp92II CATG 1 cut(s) 115
KroI GCCGGC 1 cut(s) 92
KroNI GCCGGC 1 cut(s) 94
LpnPI CCDG 2 cut(s) 106, 180
MboII GAAGA 1 cut(s) 133
MhlI GDGCHC 1 cut(s) 84
MnlI CCTC 4 cut(s) 50, 52, 86, 118
MroNI GCCGGC 1 cut(s) 92
MspI CCGG 1 cut(s) 93
MwoI GCNNNNNNNGC 1 cut(s) 112
NaeI GCCGGC 1 cut(s) 94
NgoMIV GCCGGC 1 cut(s) 92
NlaIII CATG 1 cut(s) 115
NspI RCATGY 1 cut(s) 115
NspV TTCGAA 1 cut(s) 144
PdiI GCCGGC 1 cut(s) 94
SduI GDGCHC 1 cut(s) 84
SetI ASST 4 cut(s) 69, 104, 161, 180
SfcI CTRYAG 1 cut(s) 200
SfuI TTCGAA 1 cut(s) 144
StyI CCWWGG 1 cut(s) 63
TaqI TCGA 3 cut(s) 12, 84, 144
TaqII GACCGA 1 cut(s) 32
TspDTI ATGAA 2 cut(s) 123, 201
XceI RCATGY 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.