Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr16

Orthogroup ID

OG0004490

Physical Location & Seq

Genomic Coordinates Reverse (-)

28776711 .. 28776998

Gene Structure 288 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom16g26360.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 288 bp

ATGCATTCTTATCCTGCCACTAGCTTCGGGATGGAATCCTGGGATAATACCAATTCGATTGTCTTTTCAGCTCCGCCAAGTAAACGAGCTAAAAATATGGATGTTGACATATTTGACTGCCTCAATACTTTAGAATCTCATTTTAGCCTTCCCCAGACGTCTTTAGAAATGGCAACAATAGAGAAGCTACTACACATTCCTGAAGATTCTGTTCCTTGCAAAATCCGTGCTAAGCGTGGCCATACAACATATCAAAGGCCTTCAACATCAAATCCAGGATCTTCATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000976 GO:0000981 GO:0001046 GO:0001047 GO:0001067 GO:0001228 GO:0003674 GO:0003676 GO:0003677 GO:0003690 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0006139 GO:0006351 GO:0006355 GO:0006357 GO:0006366 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009889 GO:0009891 GO:0009893 GO:0009987 GO:0010119 GO:0010467 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0010628 GO:0016070 GO:0018130 GO:0019219 GO:0019222 GO:0019438 GO:0031323 GO:0031325 GO:0031326 GO:0031328 GO:0032774 GO:0034641 GO:0034645 GO:0034654 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044212 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044271 GO:0044424 GO:0044444 GO:0044464 GO:0045893 GO:0045935 GO:0045944 GO:0046483 GO:0048518 GO:0048522 GO:0050789 GO:0050794 GO:0051171 GO:0051173 GO:0051252 GO:0051254 GO:0060255 GO:0065007 GO:0071704 GO:0080090 GO:0090304 GO:0097159 GO:0097659 GO:0140110 GO:1901360 GO:1901362 GO:1901363 GO:1901576 GO:1902680 GO:1903506 GO:1903508 GO:1990837 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HLH

Protein Analysis

96

Amino Acids

10.59

Weight (kDa)

6.39

Isoelectric Point (pI)

56.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004490)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G05805
fragaria_vesca	FvH4_4g11732 FvH4_4g11732 FvH4_4g11732 FvH4_4g11732 FvH4_4g11732 FvH4_4g11732 FvH4_4g11732 FvH4_4g11732 FvH4_4g11740
malus_domestica	MD04G1033000.v1.1 MD05G1062100.v1.1 MD07G1058200.v1.1
prunus_persica	Prupe.1G181300_v2.0.a1 Prupe.1G181300_v2.0.a1
pyrus_communis	pycom04g02710 pycom16g26360
rosa_chinensis	RchiOBHm_Chr4g0409001
rosa_laevigata	RLG00000008598
rosa_multiflora	Rmu_sc0006766.1_g000012
rosa_roxburghii	Rroxscaffold_2G00121800 Rroxscaffold_3G00239380 Rroxscaffold_5G00353460 Rroxscaffold_7G00197350
rosa_rugosa	Rorug04G0089200 Rorug04G0089300 Rorug04G0089400 Rorug04G0089500
rosa_samantha	Rh4AG153300 Rh4BG151400 Rh4CG161700 Rh4DG146600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	161
AciI	CCGC	1 cut(s)	74
AclWI	GGATC	1 cut(s)	286
AcoI	YGGCCR	1 cut(s)	238
AcuI	CTGAAG	1 cut(s)	222
AcyI	GRCGYC	1 cut(s)	158
AgsI	TTSAA	1 cut(s)	264
AjnI	CCWGG	2 cut(s)	38, 274
AluBI	AGCT	4 cut(s)	24, 71, 89, 187
AluI	AGCT	4 cut(s)	24, 71, 89, 187
AlwI	GGATC	1 cut(s)	286
AoxI	GGCC	2 cut(s)	238, 257
BalI	TGGCCA	1 cut(s)	240
BccI	CCATC	1 cut(s)	25
BciT130I	CCWGG	2 cut(s)	40, 276
BfaI	CTAG	1 cut(s)	21
BlpI	GCTNAGC	1 cut(s)	231
Bme1390I	CCNGG	2 cut(s)	40, 276
BmrFI	CCNGG	2 cut(s)	40, 276
Bpu1102I	GCTNAGC	1 cut(s)	231
BsaHI	GRCGYC	1 cut(s)	158
BsaJI	CCNNGG	1 cut(s)	39
BseBI	CCWGG	2 cut(s)	40, 276
BseDI	CCNNGG	1 cut(s)	39
BseGI	GGATG	2 cut(s)	36, 106
BshFI	GGCC	2 cut(s)	240, 259
BsmI	GAATGC	1 cut(s)	4
BsnI	GGCC	2 cut(s)	240, 259
Bsp143I	GATC	1 cut(s)	278
Bsp1720I	GCTNAGC	1 cut(s)	231
BspACI	CCGC	1 cut(s)	74
BspANI	GGCC	2 cut(s)	240, 259
BspHI	TCATGA	1 cut(s)	284
BspPI	GGATC	1 cut(s)	286
BssECI	CCNNGG	1 cut(s)	39
BssMI	GATC	1 cut(s)	278
BssNI	GRCGYC	1 cut(s)	158
Bst2UI	CCWGG	2 cut(s)	40, 276
BstACI	GRCGYC	1 cut(s)	158
BstDEI	CTNAG	1 cut(s)	231
BstF5I	GGATG	2 cut(s)	36, 106
BstKTI	GATC	1 cut(s)	281
BstMBI	GATC	1 cut(s)	278
BstNI	CCWGG	2 cut(s)	40, 276
BstSCI	CCNGG	2 cut(s)	38, 274
BstX2I	RGATCY	1 cut(s)	278
BstYI	RGATCY	1 cut(s)	278
BsuRI	GGCC	2 cut(s)	240, 259
BtsCI	GGATG	2 cut(s)	36, 106
CciI	TCATGA	1 cut(s)	284
CviAII	CATG	1 cut(s)	285
CviJI	RGCY	7 cut(s)	24, 71, 89, 147, 187, 240, 259
CviKI_1	RGCY	7 cut(s)	24, 71, 89, 147, 187, 240, 259
DdeI	CTNAG	1 cut(s)	231
DpnI	GATC	1 cut(s)	280
DpnII	GATC	1 cut(s)	278
EaeI	YGGCCR	1 cut(s)	238
EciI	GGCGGA	1 cut(s)	63
Eco147I	AGGCCT	1 cut(s)	259
Eco57I	CTGAAG	1 cut(s)	222
EcoRII	CCWGG	2 cut(s)	38, 274
EcoT22I	ATGCAT	1 cut(s)	6
FaeI	CATG	1 cut(s)	288
FaiI	YATR	5 cut(s)	98, 110, 243, 250, 286
FatI	CATG	1 cut(s)	284
FokI	GGATG	2 cut(s)	43, 113
FspBI	CTAG	1 cut(s)	21
HaeIII	GGCC	2 cut(s)	240, 259
Hin1I	GRCGYC	1 cut(s)	158
Hin1II	CATG	1 cut(s)	288
HincII	GTYRAC	1 cut(s)	106
HindII	GTYRAC	1 cut(s)	106
HinfI	GANTC	3 cut(s)	35, 134, 206
Hpy166II	GTNNAC	2 cut(s)	83, 106
Hpy188III	TCNNGA	3 cut(s)	28, 200, 285
Hpy8I	GTNNAC	2 cut(s)	83, 106
HpyAV	CCTTC	2 cut(s)	158, 270
HpyCH4IV	ACGT	1 cut(s)	158
HpyCH4V	TGCA	2 cut(s)	4, 219
HpyF3I	CTNAG	1 cut(s)	231
HpySE526I	ACGT	1 cut(s)	158
Hsp92I	GRCGYC	1 cut(s)	158
Hsp92II	CATG	1 cut(s)	288
Kzo9I	GATC	1 cut(s)	278
LmnI	GCTCC	1 cut(s)	76
LpnPI	CCDG	6 cut(s)	25, 27, 52, 167, 213, 261
MaeI	CTAG	1 cut(s)	21
MaeII	ACGT	1 cut(s)	158
MalI	GATC	1 cut(s)	280
MboI	GATC	1 cut(s)	278
MboII	GAAGA	2 cut(s)	215, 273
MflI	RGATCY	1 cut(s)	278
MlsI	TGGCCA	1 cut(s)	240
MluCI	AATT	1 cut(s)	52
MluNI	TGGCCA	1 cut(s)	240
MnlI	CCTC	1 cut(s)	131
Mox20I	TGGCCA	1 cut(s)	240
Mph1103I	ATGCAT	1 cut(s)	6
MscI	TGGCCA	1 cut(s)	240
Msp20I	TGGCCA	1 cut(s)	240
MspR9I	CCNGG	2 cut(s)	40, 276
Mva1269I	GAATGC	1 cut(s)	4
MvaI	CCWGG	2 cut(s)	40, 276
NdeII	GATC	1 cut(s)	278
NlaIII	CATG	1 cut(s)	288
NsiI	ATGCAT	1 cut(s)	6
PagI	TCATGA	1 cut(s)	284
PceI	AGGCCT	1 cut(s)	259
PctI	GAATGC	1 cut(s)	4
PfeI	GAWTC	3 cut(s)	35, 134, 206
PfoI	TCCNGGA	1 cut(s)	274
Psp6I	CCWGG	2 cut(s)	38, 274
PspGI	CCWGG	2 cut(s)	38, 274
PsuI	RGATCY	1 cut(s)	278
Sau3AI	GATC	1 cut(s)	278
ScrFI	CCNGG	2 cut(s)	40, 276
SetI	ASST	5 cut(s)	26, 73, 91, 161, 189
Sse9I	AATT	1 cut(s)	52
SseBI	AGGCCT	1 cut(s)	259
SsiI	CCGC	1 cut(s)	74
SspMI	CTAG	1 cut(s)	21
StuI	AGGCCT	1 cut(s)	259
StyD4I	CCNGG	2 cut(s)	38, 274
TaiI	ACGT	1 cut(s)	161
TaqI	TCGA	1 cut(s)	56
TasI	AATT	1 cut(s)	52
TfiI	GAWTC	3 cut(s)	35, 134, 206
TspDTI	ATGAA	1 cut(s)	273
TspGWI	ACGGA	1 cut(s)	215
XspI	CTAG	1 cut(s)	21
ZraI	GACGTC	1 cut(s)	159
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.