pycom17g22130

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
20521445 .. 20521744
300 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g22130.1

Sequence Viewer

Length: 234 bp
ATGCATGCATGCAAACATACATGTATAGTATCTCGGTCACATAACAATTTCGCATCAAAAGTGCATTTTGTCAAGAATTGCCAATTTTTCACTAACAATCTCCCCCTTTGGCATTTTCTGTTGAATAAGAAGAGTATCCAAGATAACTCTAATGATCCCAAGAAGAAGAAAATAGAGCACACTTTTAAAGAAAGCTCACAAAACAAACTAATTAGCAAAACTTTTCTTATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

9.07

Weight (kDa)

9.9

Isoelectric Point (pI)

49.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 149
AflIII ACRYGT 1 cut(s) 20
AgsI TTSAA 1 cut(s) 124
AluBI AGCT 1 cut(s) 195
AluI AGCT 1 cut(s) 195
Alw21I GWGCWC 1 cut(s) 180
AlwI GGATC 1 cut(s) 149
Bbv12I GWGCWC 1 cut(s) 180
BciVI GTATCC 1 cut(s) 146
BfuI GTATCC 1 cut(s) 146
BmsI GCATC 1 cut(s) 62
BsiHKAI GWGCWC 1 cut(s) 180
Bsp1286I GDGCHC 1 cut(s) 180
Bsp143I GATC 1 cut(s) 154
BspPI GGATC 1 cut(s) 149
BssMI GATC 1 cut(s) 154
Bst6I CTCTTC 1 cut(s) 125
BstC8I GCNNGC 2 cut(s) 6, 10
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstNSI RCATGY 3 cut(s) 8, 12, 24
BsuI GTATCC 1 cut(s) 146
Cac8I GCNNGC 2 cut(s) 6, 10
CviAII CATG 3 cut(s) 5, 9, 21
CviJI RGCY 1 cut(s) 195
CviKI_1 RGCY 1 cut(s) 195
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
DraI TTTAAA 1 cut(s) 187
Eam1104I CTCTTC 1 cut(s) 125
EarI CTCTTC 1 cut(s) 125
EcoT22I ATGCAT 2 cut(s) 6, 10
FaeI CATG 3 cut(s) 8, 12, 24
FaiI YATR 6 cut(s) 6, 10, 18, 22, 26, 42
FatI CATG 3 cut(s) 4, 8, 20
Hin1II CATG 3 cut(s) 8, 12, 24
Hpy188III TCNNGA 1 cut(s) 73
HpyCH4V TGCA 4 cut(s) 4, 8, 12, 64
Hsp92II CATG 3 cut(s) 8, 12, 24
Kzo9I GATC 1 cut(s) 154
LweI GCATC 1 cut(s) 62
MaeIII GTNAC 1 cut(s) 36
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 3 cut(s) 142, 175, 178
MhlI GDGCHC 1 cut(s) 180
MluCI AATT 4 cut(s) 46, 76, 83, 210
Mph1103I ATGCAT 2 cut(s) 6, 10
MseI TTAA 1 cut(s) 186
NdeII GATC 1 cut(s) 154
NlaIII CATG 3 cut(s) 8, 12, 24
NmuCI GTSAC 1 cut(s) 36
NsiI ATGCAT 2 cut(s) 6, 10
NspI RCATGY 3 cut(s) 8, 12, 24
PaeI GCATGC 2 cut(s) 8, 12
PciI ACATGT 1 cut(s) 20
PscI ACATGT 1 cut(s) 20
SaqAI TTAA 1 cut(s) 186
Sau3AI GATC 1 cut(s) 154
SduI GDGCHC 1 cut(s) 180
SetI ASST 1 cut(s) 197
SfaNI GCATC 1 cut(s) 62
SgeI CNNG 7 cut(s) 17, 21, 33, 45, 85, 152, 172
SphI GCATGC 2 cut(s) 8, 12
Sse9I AATT 4 cut(s) 46, 76, 83, 210
TaqII GACCGA 1 cut(s) 24
TasI AATT 4 cut(s) 46, 76, 83, 210
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TseFI GTSAC 1 cut(s) 36
Tsp45I GTSAC 1 cut(s) 36
XceI RCATGY 3 cut(s) 8, 12, 24
Zsp2I ATGCAT 2 cut(s) 6, 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.