pycom17g24140

f-box protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
22428490 .. 22428895
406 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g24140.1

Sequence Viewer

Length: 195 bp
ATGAATCTAGTCTTTCAAATTATATCCCGAGGAAATCGACTAACGATGTCAGAATACCTTCCTGAAGAAATTATTATCCAAATTCTTCTTAGGCTTCCCGTCAAACCTTTGATTCAGTTCACCTGTGTCTGCAGATCTTGGAACTCCATCATTAAACACACTAGCTTCATCAACAGACACCTCAACGTTAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.57

Weight (kDa)

9.84

Isoelectric Point (pI)

51.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box-like PF12937 19 - 56 3.4e-10 F-box-like
F-box PF00646 20 - 56 9.3e-11 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 186
AcsI RAATTY 1 cut(s) 81
AcuI CTGAAG 1 cut(s) 84
AgsI TTSAA 1 cut(s) 17
AluBI AGCT 1 cut(s) 165
AluI AGCT 1 cut(s) 165
Ama87I CYCGRG 1 cut(s) 27
ApoI RAATTY 1 cut(s) 81
Asp700I GAANNNNTTC 1 cut(s) 57
AsuHPI GGTGA 1 cut(s) 112
AvaI CYCGRG 1 cut(s) 27
BccI CCATC 1 cut(s) 155
BfaI CTAG 2 cut(s) 8, 162
BfmI CTRYAG 1 cut(s) 130
BglII AGATCT 1 cut(s) 134
BmeT110I CYCGRG 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 28
BseDI CCNNGG 1 cut(s) 28
BsiHKCI CYCGRG 1 cut(s) 27
BsoBI CYCGRG 1 cut(s) 27
Bsp143I GATC 1 cut(s) 134
BspMAI CTGCAG 1 cut(s) 134
BssECI CCNNGG 1 cut(s) 28
BssMI GATC 1 cut(s) 134
BstDEI CTNAG 1 cut(s) 89
BstKTI GATC 1 cut(s) 137
BstMBI GATC 1 cut(s) 134
BstSFI CTRYAG 1 cut(s) 130
BstX2I RGATCY 1 cut(s) 134
BstYI RGATCY 1 cut(s) 134
CviJI RGCY 2 cut(s) 94, 165
CviKI_1 RGCY 2 cut(s) 94, 165
DdeI CTNAG 1 cut(s) 89
DpnI GATC 1 cut(s) 136
DpnII GATC 1 cut(s) 134
Eco57I CTGAAG 1 cut(s) 84
Eco88I CYCGRG 1 cut(s) 27
FaiI YATR 1 cut(s) 23
FspBI CTAG 2 cut(s) 8, 162
HincII GTYRAC 1 cut(s) 190
HindII GTYRAC 1 cut(s) 190
HinfI GANTC 2 cut(s) 4, 112
HpaI GTTAAC 1 cut(s) 190
HphI GGTGA 1 cut(s) 112
Hpy166II GTNNAC 2 cut(s) 120, 190
Hpy188I TCNGA 1 cut(s) 52
Hpy188III TCNNGA 2 cut(s) 27, 62
Hpy8I GTNNAC 2 cut(s) 120, 190
HpyAV CCTTC 1 cut(s) 68
HpyCH4IV ACGT 1 cut(s) 186
HpyCH4V TGCA 1 cut(s) 132
HpyF3I CTNAG 1 cut(s) 89
HpySE526I ACGT 1 cut(s) 186
KspAI GTTAAC 1 cut(s) 190
Kzo9I GATC 1 cut(s) 134
LpnPI CCDG 2 cut(s) 75, 136
MaeI CTAG 2 cut(s) 8, 162
MaeII ACGT 1 cut(s) 186
MalI GATC 1 cut(s) 136
MboI GATC 1 cut(s) 134
MboII GAAGA 2 cut(s) 77, 77
MflI RGATCY 1 cut(s) 134
MluCI AATT 3 cut(s) 18, 69, 81
MnlI CCTC 2 cut(s) 23, 191
MroXI GAANNNNTTC 1 cut(s) 57
MseI TTAA 2 cut(s) 153, 189
NdeII GATC 1 cut(s) 134
PdmI GAANNNNTTC 1 cut(s) 57
PfeI GAWTC 2 cut(s) 4, 112
Psp1406I AACGTT 1 cut(s) 186
PstI CTGCAG 1 cut(s) 134
PsuI RGATCY 1 cut(s) 134
SaqAI TTAA 2 cut(s) 153, 189
Sau3AI GATC 1 cut(s) 134
SetI ASST 6 cut(s) 60, 109, 125, 167, 183, 189
SfcI CTRYAG 1 cut(s) 130
SgeI CNNG 8 cut(s) 20, 39, 41, 74, 110, 135, 150, 174
Sse9I AATT 3 cut(s) 18, 69, 81
SspMI CTAG 2 cut(s) 8, 162
TaiI ACGT 1 cut(s) 189
TaqI TCGA 1 cut(s) 37
TasI AATT 3 cut(s) 18, 69, 81
TfiI GAWTC 2 cut(s) 4, 112
Tru1I TTAA 2 cut(s) 153, 189
Tru9I TTAA 2 cut(s) 153, 189
TspDTI ATGAA 2 cut(s) 17, 157
XapI RAATTY 1 cut(s) 81
XmnI GAANNNNTTC 1 cut(s) 57
XspI CTAG 2 cut(s) 8, 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.