Rh2AG328700

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
47290904 .. 47291269
366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG328700.1

Sequence Viewer

Length: 366 bp
ATGTCAGATTATCTTCCAAATGAAGTTCTAATAGATATACTAGTGAGACTACCTGTGAAGTCACTGCTGAGATTCAGGAGTGTTTCGAAGATATGGAACTCTCTCATTTCTAGCCCTGCATTCATCAACACCCATCTCAACCAAGCTCTTCTTCAACAAACCAACCAGGAACTGCTTCTCTTTCGATACTACTATTCCATAGATTATGTAATGGAAGATGACCTTGGAATGCACATGACAGTCAATGACAGGCGTGAAGAACGCTTCTCTTTGCACATAGATGATGAATCCTTTCCCCACAATCCCTACTTGAACTTGATTTCCCATATAGATGTGGGGGCTACTATAAACATTACTTCCAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

121

Amino Acids

14.18

Weight (kDa)

5.38

Isoelectric Point (pI)

63.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box-like PF12937 4 - 40 8.8e-10 F-box-like
F-box PF00646 5 - 41 8.4e-11 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 155, 313
AhlI ACTAGT 1 cut(s) 40
AjnI CCWGG 1 cut(s) 165
AjuI GAANNNNNNNTTGG 4 cut(s) 135, 167, 207, 239
AloI GAACNNNNNNTCC 2 cut(s) 305, 337
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
Alw26I GTCTC 1 cut(s) 40
AlwNI CAGNNNCTG 1 cut(s) 172
Asp700I GAANNNNTTC 2 cut(s) 174, 291
AsuII TTCGAA 1 cut(s) 86
BccI CCATC 1 cut(s) 141
BciT130I CCWGG 1 cut(s) 167
BcoDI GTCTC 1 cut(s) 40
BcuI ACTAGT 1 cut(s) 40
BfaI CTAG 2 cut(s) 41, 111
Bme1390I CCNGG 1 cut(s) 167
BmrFI CCNGG 1 cut(s) 167
Bpu14I TTCGAA 1 cut(s) 86
BsaJI CCNNGG 1 cut(s) 223
BseBI CCWGG 1 cut(s) 167
BseDI CCNNGG 1 cut(s) 223
BseMII CTCAG 1 cut(s) 59
BsmAI GTCTC 1 cut(s) 40
BsmI GAATGC 2 cut(s) 119, 234
Bsp119I TTCGAA 1 cut(s) 86
BspCNI CTCAG 1 cut(s) 60
BspQI GCTCTTC 1 cut(s) 153
BspT104I TTCGAA 1 cut(s) 86
BssECI CCNNGG 1 cut(s) 223
BssT1I CCWWGG 1 cut(s) 223
Bst2UI CCWGG 1 cut(s) 167
Bst4CI ACNGT 1 cut(s) 241
Bst6I CTCTTC 1 cut(s) 153
BstBI TTCGAA 1 cut(s) 86
BstDEI CTNAG 1 cut(s) 68
BstMAI GTCTC 1 cut(s) 40
BstNI CCWGG 1 cut(s) 167
BstSCI CCNGG 1 cut(s) 165
BtsI GCAGTG 1 cut(s) 62
BtsIMutI CAGTG 1 cut(s) 62
CaiI CAGNNNCTG 1 cut(s) 172
CviAII CATG 1 cut(s) 235
CviJI RGCY 3 cut(s) 114, 146, 341
CviKI_1 RGCY 3 cut(s) 114, 146, 341
DdeI CTNAG 1 cut(s) 68
Eam1104I CTCTTC 1 cut(s) 153
EarI CTCTTC 1 cut(s) 153
Eco130I CCWWGG 1 cut(s) 223
EcoRII CCWGG 1 cut(s) 165
EcoT14I CCWWGG 1 cut(s) 223
ErhI CCWWGG 1 cut(s) 223
FaeI CATG 1 cut(s) 238
FaiI YATR 9 cut(s) 38, 94, 200, 207, 236, 278, 327, 329, 347
FalI AAGNNNNNCTT 4 cut(s) 135, 167, 207, 239
FatI CATG 1 cut(s) 234
FspBI CTAG 2 cut(s) 41, 111
Hin1II CATG 1 cut(s) 238
HinfI GANTC 2 cut(s) 72, 287
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 76
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4V TGCA 3 cut(s) 119, 232, 274
HpyF3I CTNAG 1 cut(s) 68
Hsp92II CATG 1 cut(s) 238
LguI GCTCTTC 1 cut(s) 153
LpnPI CCDG 6 cut(s) 61, 66, 129, 152, 179, 235
MaeI CTAG 2 cut(s) 41, 111
MaeIII GTNAC 1 cut(s) 60
MboII GAAGA 6 cut(s) 5, 100, 140, 143, 227, 269
MroXI GAANNNNTTC 2 cut(s) 174, 291
MslI CAYNNNNRTG 2 cut(s) 279, 330
MspR9I CCNGG 1 cut(s) 167
Mva1269I GAATGC 2 cut(s) 119, 234
MvaI CCWGG 1 cut(s) 167
NlaIII CATG 1 cut(s) 238
NmuCI GTSAC 1 cut(s) 60
NspV TTCGAA 1 cut(s) 86
PciSI GCTCTTC 1 cut(s) 153
PctI GAATGC 2 cut(s) 119, 234
PdmI GAANNNNTTC 2 cut(s) 174, 291
PfeI GAWTC 2 cut(s) 72, 287
Psp6I CCWGG 1 cut(s) 165
PspGI CCWGG 1 cut(s) 165
PstNI CAGNNNCTG 1 cut(s) 172
RseI CAYNNNNRTG 2 cut(s) 279, 330
SapI GCTCTTC 1 cut(s) 153
ScrFI CCNGG 1 cut(s) 167
SetI ASST 3 cut(s) 55, 148, 225
SfuI TTCGAA 1 cut(s) 86
SmiMI CAYNNNNRTG 2 cut(s) 279, 330
SpeI ACTAGT 1 cut(s) 40
SspMI CTAG 2 cut(s) 41, 111
StyD4I CCNGG 1 cut(s) 165
StyI CCWWGG 1 cut(s) 223
TaaI ACNGT 1 cut(s) 241
TaqI TCGA 2 cut(s) 86, 184
TfiI GAWTC 2 cut(s) 72, 287
TscAI CASTG 1 cut(s) 69
TseFI GTSAC 1 cut(s) 60
Tsp45I GTSAC 1 cut(s) 60
TspDTI ATGAA 3 cut(s) 36, 112, 300
TspRI CASTG 1 cut(s) 69
XmnI GAANNNNTTC 2 cut(s) 174, 291
XspI CTAG 2 cut(s) 41, 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.