pycom17g26110

rRNA-processing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
24421355 .. 24422765
1411 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g26110.1

Sequence Viewer

Length: 348 bp
ATGACTGAATTGGAATACAAGATGTTGAAGAAGAAAAAGAATATTCTGAATTCTCATGAAAAAGACGATCCCTCTGGTGAAGAAGATGGTTCTGGAGATCAGAACATGGAAGCGCAGGTTGTAGCAAAAGGGGATACCGCTAGGAAAGGATTGGGAGTGAAGGATAAAGTTCAATTTAAGAGAAAGAGGGCAAAGGGTCCAAACCCCCTTTCGTGTAAGAAGAAAAAGATGAAAAACACTGATCGTCATTCTCTACAGGAAAGGAAGGATGGAGATGCTACTTTGAGGAGTCGTAAGAAACGGAGTAGATCACGGAAAGGCAAAAAGACTCTGGAGGCTGGTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

12.98

Weight (kDa)

10.17

Isoelectric Point (pI)

53.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UTP23_sensor PF24779 59 - 77 1.2e-09 UTP23 sensor motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 106
AciI CCGC 1 cut(s) 138
AclWI GGATC 1 cut(s) 62
AcsI RAATTY 1 cut(s) 49
AgsI TTSAA 2 cut(s) 28, 173
AjuI GAANNNNNNNTTGG 2 cut(s) 193, 225
AlwI GGATC 1 cut(s) 62
ApoI RAATTY 1 cut(s) 49
AspLEI GCGC 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 197
AsuHPI GGTGA 1 cut(s) 89
AvaII GGWCC 1 cut(s) 197
BccI CCATC 2 cut(s) 80, 263
BciVI GTATCC 1 cut(s) 127
BfaI CTAG 1 cut(s) 141
BfmI CTRYAG 1 cut(s) 254
BfuAI ACCTGC 1 cut(s) 106
BfuI GTATCC 1 cut(s) 127
Bme18I GGWCC 1 cut(s) 197
BmgT120I GGNCC 1 cut(s) 197
BmiI GGNNCC 1 cut(s) 198
BmsI GCATC 1 cut(s) 265
BpmI CTGGAG 1 cut(s) 114
BseGI GGATG 1 cut(s) 274
BseRI GAGGAG 1 cut(s) 301
Bsp143I GATC 4 cut(s) 67, 97, 241, 308
BspACI CCGC 1 cut(s) 138
BspHI TCATGA 1 cut(s) 55
BspLI GGNNCC 1 cut(s) 198
BspMI ACCTGC 1 cut(s) 106
BspPI GGATC 1 cut(s) 62
BssMI GATC 4 cut(s) 67, 97, 241, 308
BstF5I GGATG 1 cut(s) 274
BstHHI GCGC 1 cut(s) 115
BstKTI GATC 4 cut(s) 70, 100, 244, 311
BstMBI GATC 4 cut(s) 67, 97, 241, 308
BstSFI CTRYAG 1 cut(s) 254
BsuI GTATCC 1 cut(s) 127
BtsCI GGATG 1 cut(s) 274
BtsIMutI CAGTG 1 cut(s) 237
BveI ACCTGC 1 cut(s) 106
CciI TCATGA 1 cut(s) 55
CfoI GCGC 1 cut(s) 115
Cfr13I GGNCC 1 cut(s) 197
CviAII CATG 2 cut(s) 56, 106
CviJI RGCY 1 cut(s) 338
CviKI_1 RGCY 1 cut(s) 338
DpnI GATC 4 cut(s) 69, 99, 243, 310
DpnII GATC 4 cut(s) 67, 97, 241, 308
Eco47I GGWCC 1 cut(s) 197
EcoRI GAATTC 1 cut(s) 49
FaeI CATG 2 cut(s) 59, 109
FaiI YATR 2 cut(s) 57, 107
FatI CATG 2 cut(s) 55, 105
FokI GGATG 1 cut(s) 281
FspBI CTAG 1 cut(s) 141
GlaI GCGC 1 cut(s) 114
GsuI CTGGAG 1 cut(s) 114
HhaI GCGC 1 cut(s) 115
Hin1II CATG 2 cut(s) 59, 109
Hin6I GCGC 1 cut(s) 113
HinP1I GCGC 1 cut(s) 113
HinfI GANTC 2 cut(s) 289, 328
HphI GGTGA 1 cut(s) 89
Hpy188I TCNGA 2 cut(s) 48, 102
Hpy188III TCNNGA 3 cut(s) 56, 93, 332
HpyAV CCTTC 2 cut(s) 154, 259
Hsp92II CATG 2 cut(s) 59, 109
HspAI GCGC 1 cut(s) 113
Kzo9I GATC 4 cut(s) 67, 97, 241, 308
LpnPI CCDG 6 cut(s) 60, 78, 101, 242, 317, 324
LweI GCATC 1 cut(s) 265
MaeI CTAG 1 cut(s) 141
MalI GATC 4 cut(s) 69, 99, 243, 310
MboI GATC 4 cut(s) 67, 97, 241, 308
MboII GAAGA 5 cut(s) 40, 43, 92, 95, 232
MluCI AATT 3 cut(s) 8, 49, 173
MlyI GAGTC 2 cut(s) 298, 322
MnlI CCTC 4 cut(s) 82, 180, 279, 328
MseI TTAA 2 cut(s) 177, 346
NdeII GATC 4 cut(s) 67, 97, 241, 308
NlaIII CATG 2 cut(s) 59, 109
NlaIV GGNNCC 1 cut(s) 198
PagI TCATGA 1 cut(s) 55
PleI GAGTC 2 cut(s) 297, 322
PpsI GAGTC 2 cut(s) 297, 322
PspN4I GGNNCC 1 cut(s) 198
PspPI GGNCC 1 cut(s) 197
SaqAI TTAA 2 cut(s) 177, 346
Sau3AI GATC 4 cut(s) 67, 97, 241, 308
Sau96I GGNCC 1 cut(s) 197
SchI GAGTC 2 cut(s) 298, 322
SetI ASST 1 cut(s) 120
SfaNI GCATC 1 cut(s) 265
SfcI CTRYAG 1 cut(s) 254
SinI GGWCC 1 cut(s) 197
Sse9I AATT 3 cut(s) 8, 49, 173
SsiI CCGC 1 cut(s) 138
SspI AATATT 1 cut(s) 43
SspMI CTAG 1 cut(s) 141
TasI AATT 3 cut(s) 8, 49, 173
Tru1I TTAA 2 cut(s) 177, 346
Tru9I TTAA 2 cut(s) 177, 346
TscAI CASTG 1 cut(s) 244
TspDTI ATGAA 2 cut(s) 72, 245
TspGWI ACGGA 2 cut(s) 316, 328
TspRI CASTG 1 cut(s) 244
VpaK11BI GGWCC 1 cut(s) 197
XapI RAATTY 1 cut(s) 49
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.