RchiOBHm_Chr7g0225181

This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0005314
Physical Location & Seq
Forward (+)
47717424 .. 47721814
4391 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGAGGGCGGACGAGGAACCTGTTGATCAGAAGAAGTACCTTGAAGACTCCTGCAAGCCGAAATGTGTCAAACCATTTCTCCAATATCAGGCATGTGTTAAGAGGATCGAAGGTGACGAAAGCGGCCACAAGCATTGTACTGGACAATATTTTGACTACTGGTCTTGTGTAGACAAATGTGTTGCACCAAAGCTCTTTACTAAGCTGAAGTGA

Protein Analysis

70

Amino Acids

8.19

Weight (kDa)

8.21

Isoelectric Point (pI)

51.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UCR_hinge PF02320 9 - 70 1.8e-22 Ubiquinol-cytochrome C reductase hinge protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 171
AciI CCGC 2 cut(s) 8, 123
AclWI GGATC 1 cut(s) 113
AcoI YGGCCR 1 cut(s) 124
AfaI GTAC 2 cut(s) 38, 139
AfiI CCNNNNNNNGG 1 cut(s) 88
AgsI TTSAA 1 cut(s) 44
AhdI GACNNNNNGTC 1 cut(s) 160
AluBI AGCT 2 cut(s) 193, 205
AluI AGCT 2 cut(s) 193, 205
AlwI GGATC 1 cut(s) 113
AoxI GGCC 1 cut(s) 124
AsuHPI GGTGA 1 cut(s) 125
BbsI GAAGAC 1 cut(s) 51
BclI TGATCA 1 cut(s) 25
BisI GCNGC 1 cut(s) 124
BlsI GCNGC 1 cut(s) 125
BmeRI GACNNNNNGTC 1 cut(s) 160
BmiI GGNNCC 1 cut(s) 18
BpiI GAAGAC 1 cut(s) 51
BsaXI ACNNNNNCTCC 2 cut(s) 63, 93
Bsc4I CCNNNNNNNGG 1 cut(s) 88
Bse1I ACTGG 2 cut(s) 145, 164
BseLI CCNNNNNNNGG 1 cut(s) 88
BseNI ACTGG 2 cut(s) 145, 164
BshFI GGCC 1 cut(s) 126
BslI CCNNNNNNNGG 1 cut(s) 88
BsnI GGCC 1 cut(s) 126
Bsp143I GATC 2 cut(s) 25, 105
BspACI CCGC 2 cut(s) 8, 123
BspANI GGCC 1 cut(s) 126
BspLI GGNNCC 1 cut(s) 18
BspPI GGATC 1 cut(s) 113
BsrI ACTGG 2 cut(s) 145, 164
BssMI GATC 2 cut(s) 25, 105
BstC8I GCNNGC 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 201
BstKTI GATC 2 cut(s) 28, 108
BstMBI GATC 2 cut(s) 25, 105
BstNSI RCATGY 1 cut(s) 96
BstV2I GAAGAC 1 cut(s) 51
BsuRI GGCC 1 cut(s) 126
Cac8I GCNNGC 1 cut(s) 56
Csp6I GTAC 2 cut(s) 37, 138
CspCI CAANNNNNGTGG 2 cut(s) 116, 151
CviAII CATG 1 cut(s) 93
CviJI RGCY 4 cut(s) 58, 126, 193, 205
CviKI_1 RGCY 4 cut(s) 58, 126, 193, 205
CviQI GTAC 2 cut(s) 37, 138
DdeI CTNAG 1 cut(s) 201
DpnI GATC 2 cut(s) 27, 107
DpnII GATC 2 cut(s) 25, 105
DriI GACNNNNNGTC 1 cut(s) 160
EaeI YGGCCR 1 cut(s) 124
Eam1105I GACNNNNNGTC 1 cut(s) 160
EciI GGCGGA 1 cut(s) 23
FaeI CATG 1 cut(s) 96
FaiI YATR 1 cut(s) 94
FatI CATG 1 cut(s) 92
FbaI TGATCA 1 cut(s) 25
FblI GTMKAC 1 cut(s) 171
Fnu4HI GCNGC 1 cut(s) 124
Fsp4HI GCNGC 1 cut(s) 124
GluI GCNGC 1 cut(s) 124
HaeIII GGCC 1 cut(s) 126
Hin1II CATG 1 cut(s) 96
HinfI GANTC 1 cut(s) 47
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 1 cut(s) 30
Hpy8I GTNNAC 1 cut(s) 172
HpyAV CCTTC 1 cut(s) 104
HpyCH4V TGCA 2 cut(s) 54, 185
HpyF3I CTNAG 1 cut(s) 201
Hsp92II CATG 1 cut(s) 96
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 2 cut(s) 25, 105
LpnPI CCDG 5 cut(s) 33, 64, 74, 126, 145
MaeIII GTNAC 1 cut(s) 113
MalI GATC 2 cut(s) 27, 107
MboI GATC 2 cut(s) 25, 105
MboII GAAGA 2 cut(s) 43, 56
MlyI GAGTC 1 cut(s) 41
MnlI CCTC 2 cut(s) 7, 96
MseI TTAA 1 cut(s) 99
NdeII GATC 2 cut(s) 25, 105
NlaIII CATG 1 cut(s) 96
NlaIV GGNNCC 1 cut(s) 18
NmuCI GTSAC 1 cut(s) 113
NspI RCATGY 1 cut(s) 96
PcsI WCGNNNNNNNCGW 1 cut(s) 114
PkrI GCNGC 1 cut(s) 125
PleI GAGTC 1 cut(s) 41
PpsI GAGTC 1 cut(s) 41
PspN4I GGNNCC 1 cut(s) 18
RsaI GTAC 2 cut(s) 38, 139
RsaNI GTAC 2 cut(s) 37, 138
SaqAI TTAA 1 cut(s) 99
SatI GCNGC 1 cut(s) 124
Sau3AI GATC 2 cut(s) 25, 105
SchI GAGTC 1 cut(s) 41
SetI ASST 5 cut(s) 22, 42, 115, 195, 207
SsiI CCGC 2 cut(s) 8, 123
SspI AATATT 1 cut(s) 149
TaqI TCGA 1 cut(s) 108
TatI WGTACW 1 cut(s) 137
TauI GCSGC 1 cut(s) 126
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TseFI GTSAC 1 cut(s) 113
Tsp45I GTSAC 1 cut(s) 113
XceI RCATGY 1 cut(s) 96
XmiI GTMKAC 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.