RchiOBHm_Chr5g0059891

BP28CT (NUC211) domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
64992164 .. 64992824
661 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 174 bp
ATGATCATTTATTGCAGTTCGTCTGATGAATCTTGCCACCCTGTGTTGATCTCCATATTAGATACAATTCCTTCCAAGAATTTTGTTCACCATGTAGTTCAAATGGTCCTATCTTCCTACTTGCAGAAGTCACAGGACATTGAAAATTCAACATTATTTTCATCAGGTGATTGA

Protein Analysis

57

Amino Acids

6.35

Weight (kDa)

4.93

Isoelectric Point (pI)

62.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 79, 145
AdeI CACNNNGTG 1 cut(s) 43
AgsI TTSAA 3 cut(s) 101, 143, 150
ApoI RAATTY 2 cut(s) 79, 145
AspS9I GGNCC 1 cut(s) 106
AsuHPI GGTGA 1 cut(s) 80
AvaII GGWCC 1 cut(s) 106
BclI TGATCA 1 cut(s) 3
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
Bsp143I GATC 2 cut(s) 3, 48
BssMI GATC 2 cut(s) 3, 48
BstKTI GATC 2 cut(s) 6, 51
BstMBI GATC 2 cut(s) 3, 48
Cfr13I GGNCC 1 cut(s) 106
CviAII CATG 1 cut(s) 92
DpnI GATC 2 cut(s) 5, 50
DpnII GATC 2 cut(s) 3, 48
DraIII CACNNNGTG 1 cut(s) 43
Eco47I GGWCC 1 cut(s) 106
FaeI CATG 1 cut(s) 95
FaiI YATR 2 cut(s) 56, 93
FatI CATG 1 cut(s) 91
FbaI TGATCA 1 cut(s) 3
Hin1II CATG 1 cut(s) 95
HinfI GANTC 1 cut(s) 29
HphI GGTGA 1 cut(s) 80
Hpy166II GTNNAC 1 cut(s) 88
Hpy188I TCNGA 1 cut(s) 25
Hpy8I GTNNAC 1 cut(s) 88
HpyAV CCTTC 1 cut(s) 81
HpyCH4V TGCA 2 cut(s) 15, 124
Hsp92II CATG 1 cut(s) 95
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 2 cut(s) 3, 48
LpnPI CCDG 3 cut(s) 54, 119, 150
MaeIII GTNAC 1 cut(s) 129
MalI GATC 2 cut(s) 5, 50
MboI GATC 2 cut(s) 3, 48
MboII GAAGA 1 cut(s) 105
MluCI AATT 3 cut(s) 66, 79, 145
NdeII GATC 2 cut(s) 3, 48
NlaIII CATG 1 cut(s) 95
NmuCI GTSAC 1 cut(s) 129
PfeI GAWTC 1 cut(s) 29
PspPI GGNCC 1 cut(s) 106
Sau3AI GATC 2 cut(s) 3, 48
Sau96I GGNCC 1 cut(s) 106
SetI ASST 1 cut(s) 169
SgeI CNNG 6 cut(s) 45, 53, 88, 104, 133, 146
SinI GGWCC 1 cut(s) 106
Sse9I AATT 3 cut(s) 66, 79, 145
TasI AATT 3 cut(s) 66, 79, 145
TfiI GAWTC 1 cut(s) 29
TseFI GTSAC 1 cut(s) 129
Tsp45I GTSAC 1 cut(s) 129
TspDTI ATGAA 2 cut(s) 42, 150
VpaK11BI GGWCC 1 cut(s) 106
XapI RAATTY 2 cut(s) 79, 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.