Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8395535.1

Orthogroup ID

OG0002105

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1195

Gene Structure 1195 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8395535.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 617 bp

atgatcgtttattgcagttcgtctgatgaatcttgccagcttgcgttgatctccatattagatacagttccttccaagaattttgttcatcatgtagttccaaaggtcctatcttcctgcttgcaaaagtcacaggacatggaaaattcaacattattttcatcaggaagctgggcagagaaagttttactcattcttagaagatatccatctgaactgcatggagctgctcacaaatttctggaaaagaatgtgcaatctaagaaacggggttcggtacatgaagctctgcgtaaaatgttggatgggaatttggacaggtcactagcttgctcagaatcaaatttttggttcaggttgcatcatccagaggctgatgttcgtcgccgtacactttctgaaataaggacatcaggtcttctggaagccaagggtacaaattcgcagagtcttgtaatcatccaagatggcatattgcgacagcttcaggatgatgatcttagcgttgtcagagcggctttgtcgttagacagattgtccagtttaataaacccatctgatcttattgaagtactggacaatctgcttagaagatgcattggtcttttaacaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000462 GO:0003674 GO:0003676 GO:0003723 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0006139 GO:0006355 GO:0006356 GO:0006364 GO:0006396 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009889 GO:0009891 GO:0009893 GO:0009987 GO:0010467 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0010628 GO:0016070 GO:0016072 GO:0019219 GO:0019222 GO:0022613 GO:0030490 GO:0030515 GO:0030684 GO:0030686 GO:0031323 GO:0031325 GO:0031326 GO:0031328 GO:0031974 GO:0031981 GO:0032040 GO:0032991 GO:0034455 GO:0034470 GO:0034641 GO:0034660 GO:0042254 GO:0042274 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044085 GO:0044237 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044452 GO:0044464 GO:0045893 GO:0045935 GO:0045943 GO:0046483 GO:0048518 GO:0048522 GO:0050789 GO:0050794 GO:0051171 GO:0051173 GO:0051252 GO:0051254 GO:0060255 GO:0065007 GO:0070013 GO:0071704 GO:0071840 GO:0080090 GO:0090304 GO:0097159 GO:1901360 GO:1901363 GO:1902680 GO:1903506 GO:1903508 GO:1990904 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

ko03008 map03008

Pfam Domains

Protein Families

BP28CT U3snoRNP10

Protein Analysis

205

Amino Acids

22.95

Weight (kDa)

7.71

Isoelectric Point (pI)

61.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002105)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G06530 AT3G06530 AT3G06530 AT3G06530 AT3G06530
fragaria_vesca	FvH4_7g26990 FvH4_7g26990 FvH4_7g26990 FvH4_7g26990 FvH4_7g26990 FvH4_7g26990 FvH4_7g26990 FvH4_7g26990 FvH4_7g26990
malus_domestica	MD07G1249300.v1.1
prunus_persica	Prupe.2G273000_v2.0.a1 Prupe.2G273000_v2.0.a1 Prupe.2G273000_v2.0.a1
pyrus_communis	pycom01g18810 pycom01g18840 pycom05g24490 pycom07g22250 pycom07g22260
rosa_chinensis	RchiOBHm_Chr1g0373711 RchiOBHm_Chr1g0373721 RchiOBHm_Chr5g0059891 RchiOBHm_Chr7g0224071
rosa_laevigata	RLG00000026806
rosa_multiflora	Rmu_co8395535.1_g000001 Rmu_sc0002606.1_g000003 Rmu_sc0002606.1_g000005 Rmu_sc0010519.1_g000004 Rmu_sc0023430.1_g000002
rosa_roxburghii	Rroxscaffold_4G00284050 Rroxscaffold_5G00353230
rosa_rugosa	Rorug01G0379200
rosa_samantha	Rh1AG388500 Rh1BG352900 Rh1CG365800 Rh1DG383300 Rh3AG266200 Rh3DG308600
rosa_wichuraiana	Rw1G034670 Rw3G029530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	515
AciI	CCGC	1 cut(s)	515
AcsI	RAATTY	6 cut(s)	79, 145, 236, 310, 343, 439
AcuI	CTGAAG	1 cut(s)	470
AfaI	GTAC	4 cut(s)	279, 391, 436, 573
AgsI	TTSAA	2 cut(s)	150, 569
AhdI	GACNNNNNGTC	2 cut(s)	414, 535
AluBI	AGCT	6 cut(s)	40, 171, 227, 287, 329, 484
AluI	AGCT	6 cut(s)	40, 171, 227, 287, 329, 484
AlwNI	CAGNNNCTG	1 cut(s)	374
ApeKI	GCWGC	1 cut(s)	227
ApoI	RAATTY	6 cut(s)	79, 145, 236, 310, 343, 439
AspS9I	GGNCC	1 cut(s)	106
AvaII	GGWCC	1 cut(s)	106
BbsI	GAAGAC	1 cut(s)	410
BbvI	GCAGC	1 cut(s)	214
BccI	CCATC	4 cut(s)	217, 299, 461, 562
BceAI	ACGGC	1 cut(s)	372
BfaI	CTAG	1 cut(s)	326
BisI	GCNGC	2 cut(s)	228, 516
BlsI	GCNGC	2 cut(s)	229, 517
BmcAI	AGTACT	1 cut(s)	573
Bme18I	GGWCC	1 cut(s)	106
BmeRI	GACNNNNNGTC	2 cut(s)	414, 535
BmgT120I	GGNCC	1 cut(s)	106
BmsI	GCATC	2 cut(s)	370, 584
BpiI	GAAGAC	1 cut(s)	410
BsaBI	GATNNNNATC	2 cut(s)	208, 495
BsaJI	CCNNGG	1 cut(s)	429
Bse1I	ACTGG	2 cut(s)	540, 579
Bse8I	GATNNNNATC	2 cut(s)	208, 495
BseDI	CCNNGG	1 cut(s)	429
BseGI	GGATG	4 cut(s)	310, 364, 459, 496
BseJI	GATNNNNATC	2 cut(s)	208, 495
BseMII	CTCAG	1 cut(s)	348
BseNI	ACTGG	2 cut(s)	540, 579
BseXI	GCAGC	1 cut(s)	214
BseYI	CCCAGC	1 cut(s)	171
Bsp143I	GATC	4 cut(s)	3, 48, 496, 559
BspACI	CCGC	1 cut(s)	515
BspCNI	CTCAG	1 cut(s)	347
BsrBI	CCGCTC	1 cut(s)	515
BsrI	ACTGG	2 cut(s)	540, 579
BssECI	CCNNGG	1 cut(s)	429
BssMI	GATC	4 cut(s)	3, 48, 496, 559
BssT1I	CCWWGG	1 cut(s)	429
Bst4CI	ACNGT	1 cut(s)	67
BstC8I	GCNNGC	4 cut(s)	38, 42, 122, 331
BstDEI	CTNAG	5 cut(s)	197, 261, 334, 500, 587
BstF5I	GGATG	4 cut(s)	310, 364, 459, 496
BstKTI	GATC	4 cut(s)	6, 51, 499, 562
BstMBI	GATC	4 cut(s)	3, 48, 496, 559
BstV1I	GCAGC	1 cut(s)	214
BstV2I	GAAGAC	1 cut(s)	410
BtsCI	GGATG	4 cut(s)	310, 364, 459, 496
Cac8I	GCNNGC	4 cut(s)	38, 42, 122, 331
CaiI	CAGNNNCTG	1 cut(s)	374
Cfr13I	GGNCC	1 cut(s)	106
Csp6I	GTAC	4 cut(s)	278, 390, 435, 572
CviAII	CATG	4 cut(s)	92, 139, 221, 281
CviJI	RGCY	9 cut(s)	40, 171, 227, 287, 329, 374, 428, 484, 518
CviKI_1	RGCY	9 cut(s)	40, 171, 227, 287, 329, 374, 428, 484, 518
CviQI	GTAC	4 cut(s)	278, 390, 435, 572
DdeI	CTNAG	5 cut(s)	197, 261, 334, 500, 587
DpnI	GATC	4 cut(s)	5, 50, 498, 561
DpnII	GATC	4 cut(s)	3, 48, 496, 559
DriI	GACNNNNNGTC	2 cut(s)	414, 535
Eam1105I	GACNNNNNGTC	2 cut(s)	414, 535
Eco130I	CCWWGG	1 cut(s)	429
Eco32I	GATATC	1 cut(s)	206
Eco47I	GGWCC	1 cut(s)	106
Eco57I	CTGAAG	1 cut(s)	470
EcoO109I	RGGNCCY	1 cut(s)	106
EcoRV	GATATC	1 cut(s)	206
EcoT14I	CCWWGG	1 cut(s)	429
EcoT22I	ATGCAT	1 cut(s)	599
ErhI	CCWWGG	1 cut(s)	429
FaeI	CATG	4 cut(s)	95, 142, 224, 284
FaiI	YATR	6 cut(s)	56, 93, 140, 222, 282, 473
FatI	CATG	4 cut(s)	91, 138, 220, 280
Fnu4HI	GCNGC	2 cut(s)	228, 516
FokI	GGATG	4 cut(s)	317, 351, 446, 503
Fsp4HI	GCNGC	2 cut(s)	228, 516
FspBI	CTAG	1 cut(s)	326
GluI	GCNGC	2 cut(s)	228, 516
GsaI	CCCAGC	1 cut(s)	175
Hin1II	CATG	4 cut(s)	95, 142, 224, 284
HinfI	GANTC	3 cut(s)	29, 338, 448
Hpy166II	GTNNAC	1 cut(s)	392
Hpy188I	TCNGA	6 cut(s)	25, 214, 337, 400, 512, 559
Hpy188III	TCNNGA	5 cut(s)	165, 242, 368, 422, 488
Hpy8I	GTNNAC	1 cut(s)	392
Hpy99I	CGWCG	1 cut(s)	387
HpyAV	CCTTC	1 cut(s)	81
HpyCH4III	ACNGT	1 cut(s)	67
HpyCH4V	TGCA	6 cut(s)	15, 124, 220, 256, 361, 597
HpyF3I	CTNAG	5 cut(s)	197, 261, 334, 500, 587
Hsp92II	CATG	4 cut(s)	95, 142, 224, 284
Kzo9I	GATC	4 cut(s)	3, 48, 496, 559
LmnI	GCTCC	1 cut(s)	224
Lsp1109I	GCAGC	1 cut(s)	214
LweI	GCATC	2 cut(s)	370, 584
MaeI	CTAG	1 cut(s)	326
MaeIII	GTNAC	2 cut(s)	129, 321
MalI	GATC	4 cut(s)	5, 50, 498, 561
MbiI	CCGCTC	1 cut(s)	515
MboI	GATC	4 cut(s)	3, 48, 496, 559
MboII	GAAGA	4 cut(s)	105, 213, 410, 603
MluCI	AATT	6 cut(s)	79, 145, 236, 310, 343, 439
MlyI	GAGTC	1 cut(s)	457
MmeI	TCCRAC	1 cut(s)	282
MnlI	CCTC	1 cut(s)	364
Mph1103I	ATGCAT	1 cut(s)	599
MseI	TTAA	2 cut(s)	545, 608
NdeII	GATC	4 cut(s)	3, 48, 496, 559
NlaIII	CATG	4 cut(s)	95, 142, 224, 284
NmuCI	GTSAC	2 cut(s)	129, 321
NsiI	ATGCAT	1 cut(s)	599
PfeI	GAWTC	2 cut(s)	29, 338
PkrI	GCNGC	2 cut(s)	229, 517
PleI	GAGTC	1 cut(s)	456
PpsI	GAGTC	1 cut(s)	456
PpuMI	RGGWCCY	1 cut(s)	106
Psp5II	RGGWCCY	1 cut(s)	106
PspFI	CCCAGC	1 cut(s)	171
PspPI	GGNCC	1 cut(s)	106
PspPPI	RGGWCCY	1 cut(s)	106
PstNI	CAGNNNCTG	1 cut(s)	374
RsaI	GTAC	4 cut(s)	279, 391, 436, 573
RsaNI	GTAC	4 cut(s)	278, 390, 435, 572
SaqAI	TTAA	2 cut(s)	545, 608
SatI	GCNGC	2 cut(s)	228, 516
Sau3AI	GATC	4 cut(s)	3, 48, 496, 559
Sau96I	GGNCC	1 cut(s)	106
ScaI	AGTACT	1 cut(s)	573
SchI	GAGTC	1 cut(s)	457
SfaNI	GCATC	2 cut(s)	370, 584
SinI	GGWCC	1 cut(s)	106
Sse9I	AATT	6 cut(s)	79, 145, 236, 310, 343, 439
SsiI	CCGC	1 cut(s)	515
SspMI	CTAG	1 cut(s)	326
StyI	CCWWGG	1 cut(s)	429
TaaI	ACNGT	1 cut(s)	67
TasI	AATT	6 cut(s)	79, 145, 236, 310, 343, 439
TatI	WGTACW	1 cut(s)	571
TauI	GCSGC	1 cut(s)	518
TfiI	GAWTC	2 cut(s)	29, 338
Tru1I	TTAA	2 cut(s)	545, 608
Tru9I	TTAA	2 cut(s)	545, 608
TseFI	GTSAC	2 cut(s)	129, 321
TseI	GCWGC	1 cut(s)	227
Tsp45I	GTSAC	2 cut(s)	129, 321
TspDTI	ATGAA	4 cut(s)	42, 77, 150, 297
VpaK11BI	GGWCC	1 cut(s)	106
XapI	RAATTY	6 cut(s)	79, 145, 236, 310, 343, 439
XspI	CTAG	1 cut(s)	326
ZrmI	AGTACT	1 cut(s)	573
Zsp2I	ATGCAT	1 cut(s)	599

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.