RchiOBHm_Chr4g0407281
TCP Family

assists the folding of proteins upon ATP hydrolysis

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
29377160 .. 29377979
820 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 162 bp
ATGGTGGAGATTATGCACATGCGCCATAAATTTGATGCAGATACACGTTTGGTTGAGGGTCTTGTCCTTGATCATGGTTCTAGGCATCCTGATATGAAGCGACGAGCAGAGAATTGTTACATCTTGACAGCCAATGTATCTCTGGAGTACGAGAAAAGGTAA

Protein Analysis

53

Amino Acids

6.31

Weight (kDa)

6.9

Isoelectric Point (pI)

56.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cpn60_TCP1 PF00118 1 - 52 3.8e-11 TCP-1/cpn60 chaperonin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 29
AfaI GTAC 1 cut(s) 149
AflIII ACRYGT 1 cut(s) 44
ApoI RAATTY 1 cut(s) 29
AspLEI GCGC 1 cut(s) 24
BclI TGATCA 1 cut(s) 70
BfaI CTAG 1 cut(s) 81
BmsI GCATC 2 cut(s) 25, 94
BseGI GGATG 1 cut(s) 85
Bsp143I GATC 1 cut(s) 70
BssMI GATC 1 cut(s) 70
BstF5I GGATG 1 cut(s) 85
BstHHI GCGC 1 cut(s) 24
BstKTI GATC 1 cut(s) 73
BstMBI GATC 1 cut(s) 70
BstNSI RCATGY 1 cut(s) 22
BtsCI GGATG 1 cut(s) 85
CfoI GCGC 1 cut(s) 24
Csp6I GTAC 1 cut(s) 148
CviAII CATG 2 cut(s) 19, 74
CviJI RGCY 1 cut(s) 131
CviKI_1 RGCY 1 cut(s) 131
CviQI GTAC 1 cut(s) 148
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
FaeI CATG 2 cut(s) 22, 77
FaiI YATR 5 cut(s) 14, 20, 27, 75, 95
FatI CATG 2 cut(s) 18, 73
FbaI TGATCA 1 cut(s) 70
FokI GGATG 1 cut(s) 72
FspBI CTAG 1 cut(s) 81
GlaI GCGC 1 cut(s) 23
HhaI GCGC 1 cut(s) 24
Hin1II CATG 2 cut(s) 22, 77
Hin6I GCGC 1 cut(s) 22
HinP1I GCGC 1 cut(s) 22
Hpy188III TCNNGA 3 cut(s) 89, 124, 143
Hpy99I CGWCG 1 cut(s) 105
HpyCH4IV ACGT 1 cut(s) 46
HpyCH4V TGCA 2 cut(s) 16, 38
HpySE526I ACGT 1 cut(s) 46
Hsp92II CATG 2 cut(s) 22, 77
HspAI GCGC 1 cut(s) 22
Ksp22I TGATCA 1 cut(s) 70
Kzo9I GATC 1 cut(s) 70
LpnPI CCDG 2 cut(s) 102, 128
LweI GCATC 2 cut(s) 25, 94
MaeI CTAG 1 cut(s) 81
MaeII ACGT 1 cut(s) 46
MaeIII GTNAC 1 cut(s) 116
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MluCI AATT 2 cut(s) 29, 112
MnlI CCTC 1 cut(s) 49
NdeII GATC 1 cut(s) 70
NlaIII CATG 2 cut(s) 22, 77
NspI RCATGY 1 cut(s) 22
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
Sau3AI GATC 1 cut(s) 70
SetI ASST 2 cut(s) 49, 161
SfaNI GCATC 2 cut(s) 25, 94
Sse9I AATT 2 cut(s) 29, 112
SspMI CTAG 1 cut(s) 81
TaiI ACGT 1 cut(s) 49
TasI AATT 2 cut(s) 29, 112
TspDTI ATGAA 1 cut(s) 110
XapI RAATTY 1 cut(s) 29
XceI RCATGY 1 cut(s) 22
XcmI CCANNNNNNNNNTGG 1 cut(s) 139
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.