Rmu_sc0000474.1_g000003
TCP Family

assists the folding of proteins upon ATP hydrolysis

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000474.1
Physical Location & Seq
Reverse (-)
27180 .. 28154
975 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000474.1_g000003.1.cds

Sequence Viewer

Length: 309 bp
atgcatccacgtgtcctggttgatggttttgagattgccaaaagtgcaacacttcaatttatcgagaaatttaaaactcctgtggtaatgggcagtgagcctgacaaagaaatcctaaaaatggtagcaaggacaactgtgcgaacaaagttacatgaagcattggctgatcaattgactgacatagttgtaaatgcggttgagggtcttgtccttgatcatggttctaggcatcctgatatgaagcgacgagcagagaattgttacatcttgacagccaatgtatctctggagtacgagaaaaggtaa

Protein Analysis

102

Amino Acids

11.56

Weight (kDa)

6.91

Isoelectric Point (pI)

42.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 197
AcsI RAATTY 1 cut(s) 68
AcvI CACGTG 1 cut(s) 11
AfaI GTAC 1 cut(s) 296
AfiI CCNNNNNNNGG 1 cut(s) 121
AflIII ACRYGT 1 cut(s) 10
AgsI TTSAA 1 cut(s) 56
AjnI CCWGG 1 cut(s) 15
ApoI RAATTY 1 cut(s) 68
BbrPI CACGTG 1 cut(s) 11
BccI CCATC 1 cut(s) 17
BciT130I CCWGG 1 cut(s) 17
BclI TGATCA 2 cut(s) 169, 217
BfaI CTAG 1 cut(s) 228
Bme1390I CCNGG 1 cut(s) 17
BmrFI CCNGG 1 cut(s) 17
BmsI GCATC 2 cut(s) 13, 241
BsaAI YACGTR 1 cut(s) 11
Bsc4I CCNNNNNNNGG 1 cut(s) 121
BseBI CCWGG 1 cut(s) 17
BseGI GGATG 2 cut(s) 4, 232
BseLI CCNNNNNNNGG 1 cut(s) 121
BslI CCNNNNNNNGG 1 cut(s) 121
Bsp143I GATC 2 cut(s) 169, 217
BspACI CCGC 1 cut(s) 197
BssMI GATC 2 cut(s) 169, 217
Bst2UI CCWGG 1 cut(s) 17
Bst4CI ACNGT 1 cut(s) 139
BstBAI YACGTR 1 cut(s) 11
BstF5I GGATG 2 cut(s) 4, 232
BstKTI GATC 2 cut(s) 172, 220
BstMBI GATC 2 cut(s) 169, 217
BstMWI GCNNNNNNNGC 1 cut(s) 44
BstNI CCWGG 1 cut(s) 17
BstSCI CCNGG 1 cut(s) 15
BtsCI GGATG 2 cut(s) 4, 232
BtsI GCAGTG 1 cut(s) 100
BtsIMutI CAGTG 1 cut(s) 100
Csp6I GTAC 1 cut(s) 295
CviAII CATG 2 cut(s) 155, 221
CviJI RGCY 3 cut(s) 100, 167, 278
CviKI_1 RGCY 3 cut(s) 100, 167, 278
CviQI GTAC 1 cut(s) 295
DpnI GATC 2 cut(s) 171, 219
DpnII GATC 2 cut(s) 169, 217
DraI TTTAAA 1 cut(s) 73
Eco72I CACGTG 1 cut(s) 11
EcoRII CCWGG 1 cut(s) 15
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 158, 224
FaiI YATR 4 cut(s) 156, 185, 222, 242
FatI CATG 2 cut(s) 154, 220
FbaI TGATCA 2 cut(s) 169, 217
FokI GGATG 1 cut(s) 219
FspBI CTAG 1 cut(s) 228
Hin1II CATG 2 cut(s) 158, 224
Hpy188III TCNNGA 4 cut(s) 64, 236, 271, 290
Hpy99I CGWCG 1 cut(s) 252
HpyCH4III ACNGT 1 cut(s) 139
HpyCH4IV ACGT 1 cut(s) 10
HpyCH4V TGCA 2 cut(s) 4, 47
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
HpySE526I ACGT 1 cut(s) 10
Hsp92II CATG 2 cut(s) 158, 224
Ksp22I TGATCA 2 cut(s) 169, 217
Kzo9I GATC 2 cut(s) 169, 217
LpnPI CCDG 6 cut(s) 2, 29, 93, 114, 249, 275
LweI GCATC 2 cut(s) 13, 241
MaeI CTAG 1 cut(s) 228
MaeII ACGT 1 cut(s) 10
MaeIII GTNAC 2 cut(s) 150, 263
MalI GATC 2 cut(s) 171, 219
MboI GATC 2 cut(s) 169, 217
MfeI CAATTG 1 cut(s) 173
MluCI AATT 4 cut(s) 56, 68, 173, 259
MnlI CCTC 1 cut(s) 196
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 72
MslI CAYNNNNRTG 1 cut(s) 9
MspR9I CCNGG 1 cut(s) 17
MunI CAATTG 1 cut(s) 173
MvaI CCWGG 1 cut(s) 17
MwoI GCNNNNNNNGC 1 cut(s) 44
NdeII GATC 2 cut(s) 169, 217
NlaIII CATG 2 cut(s) 158, 224
NsiI ATGCAT 1 cut(s) 6
PmaCI CACGTG 1 cut(s) 11
PmlI CACGTG 1 cut(s) 11
Ppu21I YACGTR 1 cut(s) 11
Psp6I CCWGG 1 cut(s) 15
PspCI CACGTG 1 cut(s) 11
PspGI CCWGG 1 cut(s) 15
RsaI GTAC 1 cut(s) 296
RsaNI GTAC 1 cut(s) 295
RseI CAYNNNNRTG 1 cut(s) 9
SaqAI TTAA 1 cut(s) 72
Sau3AI GATC 2 cut(s) 169, 217
ScrFI CCNGG 1 cut(s) 17
SetI ASST 2 cut(s) 13, 308
SfaNI GCATC 2 cut(s) 13, 241
SmiMI CAYNNNNRTG 1 cut(s) 9
Sse9I AATT 4 cut(s) 56, 68, 173, 259
SsiI CCGC 1 cut(s) 197
SspMI CTAG 1 cut(s) 228
StyD4I CCNGG 1 cut(s) 15
TaaI ACNGT 1 cut(s) 139
TaiI ACGT 1 cut(s) 13
TaqI TCGA 1 cut(s) 63
TasI AATT 4 cut(s) 56, 68, 173, 259
Tru1I TTAA 1 cut(s) 72
Tru9I TTAA 1 cut(s) 72
TscAI CASTG 1 cut(s) 100
TspDTI ATGAA 2 cut(s) 171, 257
TspRI CASTG 1 cut(s) 100
XapI RAATTY 1 cut(s) 68
XcmI CCANNNNNNNNNTGG 1 cut(s) 286
XspI CTAG 1 cut(s) 228
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.