Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8186612.1

Orthogroup ID

OG0003345

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 655

Gene Structure 654 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8186612.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 227 bp

atgaaaaattcttttttgcagttacatgaagaattggctgatcaattgactgacatagttgtaaatgcggttctttgcatccgcaaacctgaggaggcaattgatctatttatggtggagattatgcacatgcgccataaatttgatgcagacacacgtttggttgagggtcttgtccttgatcatggttctaggcatcctgatatgaagcgacgagcagagaattg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0005832 GO:0006457 GO:0006458 GO:0008150 GO:0009987 GO:0010035 GO:0010038 GO:0010043 GO:0016020 GO:0032991 GO:0042221 GO:0044183 GO:0044424 GO:0044444 GO:0044445 GO:0044464 GO:0046686 GO:0050896 GO:0051082 GO:0061077 GO:0101031

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cpn60_TCP1

Protein Analysis

75

Amino Acids

8.77

Weight (kDa)

5.64

Isoelectric Point (pI)

49.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003345)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G02530 AT5G16070
fragaria_vesca	FvH4_1g11210
malus_domestica	MD09G1086000.v1.1 MD17G1104900.v1.1
prunus_persica	Prupe.3G238800_v2.0.a1
pyrus_communis	pycom09g01130 pycom17g07580
rosa_chinensis	RchiOBHm_Chr2g0098621 RchiOBHm_Chr2g0138531 RchiOBHm_Chr4g0407281 RchiOBHm_Chr4g0409191 RchiOBHm_Chr6g0270681
rosa_laevigata	RLG00000013776 RLG00000016815
rosa_multiflora	Rmu_co8186612.1_g000001 Rmu_sc0000474.1_g000003 Rmu_sc0002106.1_g000012 Rmu_sc0002776.1_g000012
rosa_roxburghii	Rroxscaffold_2G00143840 Rroxscaffold_7G00197690
rosa_rugosa	Rorug02G0073800 Rorug06G0055700
rosa_samantha	Rh2AG121400 Rh2BG125000 Rh2CG126000 Rh2DG127100 Rh5BG537700 Rh6AG175000 Rh6AG275700 Rh6CG174300 Rh6DG166700 Rh7CG256600
rosa_wichuraiana	Rw0G004140 Rw0G012590 Rw6G014910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	68, 82
AcsI	RAATTY	2 cut(s)	7, 140
AflIII	ACRYGT	1 cut(s)	155
ApoI	RAATTY	2 cut(s)	7, 140
AspLEI	GCGC	1 cut(s)	135
AxyI	CCTNAGG	1 cut(s)	90
BclI	TGATCA	2 cut(s)	40, 181
BfaI	CTAG	1 cut(s)	192
BmsI	GCATC	3 cut(s)	87, 136, 205
Bse21I	CCTNAGG	1 cut(s)	90
BseGI	GGATG	2 cut(s)	78, 196
BseMII	CTCAG	1 cut(s)	81
BseRI	GAGGAG	1 cut(s)	107
Bsp143I	GATC	3 cut(s)	40, 103, 181
BspACI	CCGC	2 cut(s)	68, 82
BspCNI	CTCAG	1 cut(s)	82
BssMI	GATC	3 cut(s)	40, 103, 181
BstDEI	CTNAG	1 cut(s)	90
BstF5I	GGATG	2 cut(s)	78, 196
BstHHI	GCGC	1 cut(s)	135
BstKTI	GATC	3 cut(s)	43, 106, 184
BstMBI	GATC	3 cut(s)	40, 103, 181
BstNSI	RCATGY	1 cut(s)	133
Bsu36I	CCTNAGG	1 cut(s)	90
BtsCI	GGATG	2 cut(s)	78, 196
CfoI	GCGC	1 cut(s)	135
CviAII	CATG	3 cut(s)	26, 130, 185
CviJI	RGCY	1 cut(s)	38
CviKI_1	RGCY	1 cut(s)	38
DdeI	CTNAG	1 cut(s)	90
DpnI	GATC	3 cut(s)	42, 105, 183
DpnII	GATC	3 cut(s)	40, 103, 181
Eco81I	CCTNAGG	1 cut(s)	90
FaeI	CATG	3 cut(s)	29, 133, 188
FaiI	YATR	8 cut(s)	27, 56, 113, 125, 131, 138, 186, 206
FatI	CATG	3 cut(s)	25, 129, 184
FbaI	TGATCA	2 cut(s)	40, 181
FokI	GGATG	2 cut(s)	65, 183
FspBI	CTAG	1 cut(s)	192
GlaI	GCGC	1 cut(s)	134
HhaI	GCGC	1 cut(s)	135
Hin1II	CATG	3 cut(s)	29, 133, 188
Hin6I	GCGC	1 cut(s)	133
HinP1I	GCGC	1 cut(s)	133
Hpy188III	TCNNGA	1 cut(s)	200
Hpy99I	CGWCG	1 cut(s)	216
HpyCH4IV	ACGT	1 cut(s)	157
HpyCH4V	TGCA	4 cut(s)	19, 78, 127, 149
HpyF3I	CTNAG	1 cut(s)	90
HpySE526I	ACGT	1 cut(s)	157
Hsp92II	CATG	3 cut(s)	29, 133, 188
HspAI	GCGC	1 cut(s)	133
Ksp22I	TGATCA	2 cut(s)	40, 181
Kzo9I	GATC	3 cut(s)	40, 103, 181
LpnPI	CCDG	2 cut(s)	102, 213
LweI	GCATC	3 cut(s)	87, 136, 205
MaeI	CTAG	1 cut(s)	192
MaeII	ACGT	1 cut(s)	157
MaeIII	GTNAC	1 cut(s)	21
MalI	GATC	3 cut(s)	42, 105, 183
MboI	GATC	3 cut(s)	40, 103, 181
MboII	GAAGA	1 cut(s)	41
MfeI	CAATTG	2 cut(s)	44, 99
MluCI	AATT	6 cut(s)	7, 32, 44, 99, 140, 223
MnlI	CCTC	3 cut(s)	85, 88, 160
MunI	CAATTG	2 cut(s)	44, 99
NdeII	GATC	3 cut(s)	40, 103, 181
NlaIII	CATG	3 cut(s)	29, 133, 188
NspI	RCATGY	1 cut(s)	133
PsrI	GAACNNNNNNTAC	2 cut(s)	54, 86
Sau3AI	GATC	3 cut(s)	40, 103, 181
SetI	ASST	2 cut(s)	91, 160
SfaNI	GCATC	3 cut(s)	87, 136, 205
SgeI	CNNG	9 cut(s)	38, 101, 142, 168, 185, 191, 197, 204, 212
Sse9I	AATT	6 cut(s)	7, 32, 44, 99, 140, 223
SsiI	CCGC	2 cut(s)	68, 82
SspMI	CTAG	1 cut(s)	192
TaiI	ACGT	1 cut(s)	160
TasI	AATT	6 cut(s)	7, 32, 44, 99, 140, 223
TspDTI	ATGAA	3 cut(s)	17, 42, 221
XapI	RAATTY	2 cut(s)	7, 140
XceI	RCATGY	1 cut(s)	133
XspI	CTAG	1 cut(s)	192

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.