RchiOBHm_Chr4g0410751

SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 3-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
34575613 .. 34579402
3790 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 168 bp
ATGTTAGGGAGAACCAAGTTTAGCATTGATCATGAAGGCCAGCCTATTTTAGTCGTTCCTCCTGCTGATATTGAGGTGATTTATTGTGAACTCACAGAAGCTGAAAAAGACTTCTATGAGGCCCTGTTTAAAAGATCAAAGGTGAAATTTGATCAATATGTCGAGTAA

Protein Analysis

55

Amino Acids

6.44

Weight (kDa)

4.83

Isoelectric Point (pI)

50.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 146
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
AlwNI CAGNNNCTG 1 cut(s) 101
AoxI GGCC 2 cut(s) 37, 120
ApoI RAATTY 1 cut(s) 146
AspS9I GGNCC 1 cut(s) 121
AsuHPI GGTGA 2 cut(s) 88, 154
BclI TGATCA 2 cut(s) 28, 151
BmgT120I GGNCC 1 cut(s) 121
BshFI GGCC 2 cut(s) 39, 122
BsnI GGCC 2 cut(s) 39, 122
Bsp143I GATC 3 cut(s) 28, 134, 151
BspANI GGCC 2 cut(s) 39, 122
BspHI TCATGA 1 cut(s) 31
BssMI GATC 3 cut(s) 28, 134, 151
BstC8I GCNNGC 1 cut(s) 41
BstKTI GATC 3 cut(s) 31, 137, 154
BstMBI GATC 3 cut(s) 28, 134, 151
BsuRI GGCC 2 cut(s) 39, 122
Cac8I GCNNGC 1 cut(s) 41
CaiI CAGNNNCTG 1 cut(s) 101
CciI TCATGA 1 cut(s) 31
Cfr13I GGNCC 1 cut(s) 121
CviAII CATG 1 cut(s) 32
CviJI RGCY 4 cut(s) 39, 43, 101, 122
CviKI_1 RGCY 4 cut(s) 39, 43, 101, 122
DpnI GATC 3 cut(s) 30, 136, 153
DpnII GATC 3 cut(s) 28, 134, 151
DraI TTTAAA 1 cut(s) 130
EcoO109I RGGNCCY 1 cut(s) 121
FaeI CATG 1 cut(s) 35
FaiI YATR 3 cut(s) 33, 117, 159
FatI CATG 1 cut(s) 31
FbaI TGATCA 2 cut(s) 28, 151
HaeIII GGCC 2 cut(s) 39, 122
Hin1II CATG 1 cut(s) 35
HphI GGTGA 2 cut(s) 88, 154
Hpy166II GTNNAC 1 cut(s) 89
Hpy188III TCNNGA 1 cut(s) 32
Hpy8I GTNNAC 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 29
Hsp92II CATG 1 cut(s) 35
Ksp22I TGATCA 2 cut(s) 28, 151
Kzo9I GATC 3 cut(s) 28, 134, 151
LpnPI CCDG 3 cut(s) 53, 75, 137
MalI GATC 3 cut(s) 30, 136, 153
MboI GATC 3 cut(s) 28, 134, 151
MluCI AATT 1 cut(s) 146
MnlI CCTC 3 cut(s) 67, 69, 112
MseI TTAA 1 cut(s) 129
NdeII GATC 3 cut(s) 28, 134, 151
NlaIII CATG 1 cut(s) 35
PagI TCATGA 1 cut(s) 31
PspPI GGNCC 1 cut(s) 121
PstNI CAGNNNCTG 1 cut(s) 101
SaqAI TTAA 1 cut(s) 129
Sau3AI GATC 3 cut(s) 28, 134, 151
Sau96I GGNCC 1 cut(s) 121
SetI ASST 3 cut(s) 78, 103, 144
SgeI CNNG 5 cut(s) 28, 44, 52, 74, 136
Sse9I AATT 1 cut(s) 146
TaqI TCGA 1 cut(s) 162
TasI AATT 1 cut(s) 146
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
TspDTI ATGAA 1 cut(s) 48
XapI RAATTY 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.