RchiOBHm_Chr2g0111901

DA1-related 1-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
23635312 .. 23635575
264 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGTTGACAGGGTCACTTCTAGCTCAACAGATGATAAGTGCATGGCTAAGGCTTAAAGGTTATCCCAACTTTTGCCCTGAGCTTGAAAAAGGTATCTGCCAATATTTGGCACATAGGTGGTTGGAGACTTGGAGTATTCTAATTCTGATTCATCTAGAAAATTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.34

Weight (kDa)

6.7

Isoelectric Point (pI)

31.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DA1-like PF12315 1 - 44 3.5e-15 Protein DA1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 106
AfiI CCNNNNNNNGG 1 cut(s) 106
AgsI TTSAA 1 cut(s) 86
AleI CACNNNNGTG 1 cut(s) 115
AluBI AGCT 2 cut(s) 23, 82
AluI AGCT 2 cut(s) 23, 82
Alw26I GTCTC 1 cut(s) 119
BcoDI GTCTC 1 cut(s) 119
BfaI CTAG 2 cut(s) 20, 155
Bpu10I CCTNAGC 2 cut(s) 47, 78
Bsc4I CCNNNNNNNGG 1 cut(s) 106
BseLI CCNNNNNNNGG 1 cut(s) 106
BseMII CTCAG 1 cut(s) 69
BslI CCNNNNNNNGG 1 cut(s) 106
BsmAI GTCTC 1 cut(s) 119
BspCNI CTCAG 1 cut(s) 70
BstDEI CTNAG 2 cut(s) 47, 78
BstMAI GTCTC 1 cut(s) 119
CviAII CATG 1 cut(s) 42
CviJI RGCY 4 cut(s) 23, 46, 52, 82
CviKI_1 RGCY 4 cut(s) 23, 46, 52, 82
DdeI CTNAG 2 cut(s) 47, 78
FaeI CATG 1 cut(s) 45
FaiI YATR 2 cut(s) 43, 114
FatI CATG 1 cut(s) 41
FspBI CTAG 2 cut(s) 20, 155
Hin1II CATG 1 cut(s) 45
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HinfI GANTC 1 cut(s) 148
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 147
Hpy188III TCNNGA 1 cut(s) 155
Hpy8I GTNNAC 1 cut(s) 6
HpyCH4V TGCA 1 cut(s) 41
HpyF3I CTNAG 2 cut(s) 47, 78
Hsp92II CATG 1 cut(s) 45
LpnPI CCDG 1 cut(s) 90
MaeI CTAG 2 cut(s) 20, 155
MaeIII GTNAC 1 cut(s) 12
MluCI AATT 2 cut(s) 141, 160
MmeI TCCRAC 1 cut(s) 102
MseI TTAA 1 cut(s) 54
MslI CAYNNNNRTG 1 cut(s) 115
NlaIII CATG 1 cut(s) 45
NmuCI GTSAC 1 cut(s) 12
OliI CACNNNNGTG 1 cut(s) 115
PfeI GAWTC 1 cut(s) 148
PflFI GACNNNGTC 1 cut(s) 10
PflMI CCANNNNNTGG 1 cut(s) 106
PsyI GACNNNGTC 1 cut(s) 10
RseI CAYNNNNRTG 1 cut(s) 115
SaqAI TTAA 1 cut(s) 54
SetI ASST 5 cut(s) 25, 61, 84, 94, 119
SgeI CNNG 6 cut(s) 21, 32, 54, 89, 95, 141
SmiMI CAYNNNNRTG 1 cut(s) 115
Sse9I AATT 2 cut(s) 141, 160
SspI AATATT 1 cut(s) 104
SspMI CTAG 2 cut(s) 20, 155
TasI AATT 2 cut(s) 141, 160
TfiI GAWTC 1 cut(s) 148
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TseFI GTSAC 1 cut(s) 12
Tsp45I GTSAC 1 cut(s) 12
TspDTI ATGAA 1 cut(s) 140
Tth111I GACNNNGTC 1 cut(s) 10
Van91I CCANNNNNTGG 1 cut(s) 106
XbaI TCTAGA 1 cut(s) 154
XspI CTAG 2 cut(s) 20, 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.