RchiOBHm_Chr2g0138261

Converts zeaxanthin into antheraxanthin and subsequently violaxanthin

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
56008632 .. 56009235
604 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGCAATGGTACACATTTCACAAGGAACCAGTTGGTGGTGCTGATGCCCCAAATGGTAAAAAGGAAAGGTTGCTTAAAATATTTGATGGGTGGTGTGATAATGTGGTAGATTTGCTACTTGCCACAGAGGAAGATGCAATTCTACGACGTGACATATATATATGA
Functional Annotation

Protein Analysis

54

Amino Acids

6.27

Weight (kDa)

4.83

Isoelectric Point (pI)

50.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 35
AfaI GTAC 1 cut(s) 11
AfiI CCNNNNNNNGG 1 cut(s) 35
AjiI CACGTC 1 cut(s) 149
BccI CCATC 1 cut(s) 80
BmgBI CACGTC 1 cut(s) 149
BmiI GGNNCC 1 cut(s) 27
BmsI GCATC 2 cut(s) 34, 124
Bsc4I CCNNNNNNNGG 1 cut(s) 35
Bse1I ACTGG 1 cut(s) 29
Bse3DI GCAATG 1 cut(s) 11
BseLI CCNNNNNNNGG 1 cut(s) 35
BseMI GCAATG 1 cut(s) 11
BseNI ACTGG 1 cut(s) 29
BslI CCNNNNNNNGG 1 cut(s) 35
BspLI GGNNCC 1 cut(s) 27
BsrDI GCAATG 1 cut(s) 11
BsrI ACTGG 1 cut(s) 29
BtrI CACGTC 1 cut(s) 149
Csp6I GTAC 1 cut(s) 10
CviQI GTAC 1 cut(s) 10
FaiI YATR 5 cut(s) 155, 157, 159, 161, 163
Hpy166II GTNNAC 1 cut(s) 12
Hpy8I GTNNAC 1 cut(s) 12
Hpy99I CGWCG 1 cut(s) 150
HpyCH4IV ACGT 1 cut(s) 148
HpyCH4V TGCA 2 cut(s) 4, 137
HpySE526I ACGT 1 cut(s) 148
LpnPI CCDG 1 cut(s) 42
LweI GCATC 2 cut(s) 34, 124
MaeII ACGT 1 cut(s) 148
MaeIII GTNAC 1 cut(s) 149
MboII GAAGA 1 cut(s) 143
MluCI AATT 1 cut(s) 138
MnlI CCTC 1 cut(s) 121
MseI TTAA 1 cut(s) 75
NlaIV GGNNCC 1 cut(s) 27
NmuCI GTSAC 1 cut(s) 149
PflMI CCANNNNNTGG 1 cut(s) 35
PspN4I GGNNCC 1 cut(s) 27
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
SaqAI TTAA 1 cut(s) 75
SetI ASST 2 cut(s) 71, 151
SfaNI GCATC 2 cut(s) 34, 124
SgeI CNNG 4 cut(s) 34, 41, 131, 161
Sse9I AATT 1 cut(s) 138
SspI AATATT 1 cut(s) 81
TaiI ACGT 1 cut(s) 151
TasI AATT 1 cut(s) 138
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TseFI GTSAC 1 cut(s) 149
Tsp45I GTSAC 1 cut(s) 149
Van91I CCANNNNNTGG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.