Rroxscaffold_2G00137970

Converts zeaxanthin into antheraxanthin and subsequently violaxanthin

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
75985841 .. 75986953
1113 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00137970.1

Sequence Viewer

Length: 246 bp
ATGCAATGGTATGCATTTCACAAGGAACCAGCTGGTGGTGCTGATGCCCCTAATGGTAAAAACCAGCGTCTGCTTAAAATATTTGATGGCTGGTGTGATAATGTGATAGATTTGCTACTGGCCACAGAGGAAGATGCAATTCTACGACGCGACATGGTATGGCAAAGGACCCCAACTTTATCCTGGGGAAAGGGTAATGTGACCTTGCTTGGAGATTCTTTGTCCATGCTATGCAACCAAATTTAG
Functional Annotation

Protein Analysis

81

Amino Acids

9.15

Weight (kDa)

5.11

Isoelectric Point (pI)

37.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 35
AccII CGCG 1 cut(s) 150
AcoI YGGCCR 1 cut(s) 120
AcsI RAATTY 1 cut(s) 240
AfiI CCNNNNNNNGG 1 cut(s) 35
AjnI CCWGG 1 cut(s) 182
AluBI AGCT 1 cut(s) 32
AluI AGCT 1 cut(s) 32
AlwNI CAGNNNCTG 1 cut(s) 70
AoxI GGCC 1 cut(s) 120
ApoI RAATTY 1 cut(s) 240
AspS9I GGNCC 1 cut(s) 168
AvaII GGWCC 1 cut(s) 168
BalI TGGCCA 1 cut(s) 122
BccI CCATC 1 cut(s) 80
BciT130I CCWGG 1 cut(s) 184
Bme1390I CCNGG 1 cut(s) 184
Bme18I GGWCC 1 cut(s) 168
BmgT120I GGNCC 1 cut(s) 168
BmiI GGNNCC 2 cut(s) 27, 170
BmrFI CCNGG 1 cut(s) 184
BmsI GCATC 2 cut(s) 34, 124
BsaJI CCNNGG 1 cut(s) 183
Bsc4I CCNNNNNNNGG 1 cut(s) 35
Bse1I ACTGG 1 cut(s) 123
Bse3DI GCAATG 1 cut(s) 11
BseBI CCWGG 1 cut(s) 184
BseDI CCNNGG 1 cut(s) 183
BseLI CCNNNNNNNGG 1 cut(s) 35
BseMI GCAATG 1 cut(s) 11
BseNI ACTGG 1 cut(s) 123
Bsh1236I CGCG 1 cut(s) 150
BshFI GGCC 1 cut(s) 122
BslI CCNNNNNNNGG 1 cut(s) 35
BsnI GGCC 1 cut(s) 122
BspANI GGCC 1 cut(s) 122
BspFNI CGCG 1 cut(s) 150
BspLI GGNNCC 2 cut(s) 27, 170
BsrDI GCAATG 1 cut(s) 11
BsrI ACTGG 1 cut(s) 123
BssECI CCNNGG 1 cut(s) 183
Bst2UI CCWGG 1 cut(s) 184
BstFNI CGCG 1 cut(s) 150
BstMWI GCNNNNNNNGC 1 cut(s) 38
BstNI CCWGG 1 cut(s) 184
BstSCI CCNGG 1 cut(s) 182
BstUI CGCG 1 cut(s) 150
BsuRI GGCC 1 cut(s) 122
CaiI CAGNNNCTG 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 168
CseI GACGC 2 cut(s) 56, 156
CviAII CATG 2 cut(s) 154, 226
CviJI RGCY 3 cut(s) 32, 90, 122
CviKI_1 RGCY 3 cut(s) 32, 90, 122
EaeI YGGCCR 1 cut(s) 120
Eco47I GGWCC 1 cut(s) 168
EcoO109I RGGNCCY 1 cut(s) 168
EcoRII CCWGG 1 cut(s) 182
EcoT22I ATGCAT 1 cut(s) 16
FaeI CATG 2 cut(s) 157, 229
FaiI YATR 5 cut(s) 12, 155, 160, 227, 232
FatI CATG 2 cut(s) 153, 225
HaeIII GGCC 1 cut(s) 122
HgaI GACGC 2 cut(s) 56, 156
Hin1II CATG 2 cut(s) 157, 229
HinfI GANTC 1 cut(s) 215
Hpy99I CGWCG 1 cut(s) 150
HpyCH4V TGCA 4 cut(s) 4, 14, 137, 234
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
Hsp92II CATG 2 cut(s) 157, 229
LpnPI CCDG 7 cut(s) 18, 42, 76, 77, 104, 169, 196
LweI GCATC 2 cut(s) 34, 124
MaeIII GTNAC 1 cut(s) 199
MboII GAAGA 1 cut(s) 143
MlsI TGGCCA 1 cut(s) 122
MluCI AATT 2 cut(s) 138, 240
MluNI TGGCCA 1 cut(s) 122
MnlI CCTC 1 cut(s) 121
Mox20I TGGCCA 1 cut(s) 122
Mph1103I ATGCAT 1 cut(s) 16
MscI TGGCCA 1 cut(s) 122
MseI TTAA 1 cut(s) 75
Msp20I TGGCCA 1 cut(s) 122
MspA1I CMGCKG 1 cut(s) 32
MspR9I CCNGG 1 cut(s) 184
MvaI CCWGG 1 cut(s) 184
MvnI CGCG 1 cut(s) 150
MwoI GCNNNNNNNGC 1 cut(s) 38
NlaIII CATG 2 cut(s) 157, 229
NlaIV GGNNCC 2 cut(s) 27, 170
NmuCI GTSAC 1 cut(s) 199
NsiI ATGCAT 1 cut(s) 16
PfeI GAWTC 1 cut(s) 215
PflMI CCANNNNNTGG 1 cut(s) 35
PpuMI RGGWCCY 1 cut(s) 168
Psp5II RGGWCCY 1 cut(s) 168
Psp6I CCWGG 1 cut(s) 182
PspGI CCWGG 1 cut(s) 182
PspN4I GGNNCC 2 cut(s) 27, 170
PspPI GGNCC 1 cut(s) 168
PspPPI RGGWCCY 1 cut(s) 168
PstNI CAGNNNCTG 1 cut(s) 70
PvuII CAGCTG 1 cut(s) 32
SaqAI TTAA 1 cut(s) 75
Sau96I GGNCC 1 cut(s) 168
ScrFI CCNGG 1 cut(s) 184
SetI ASST 2 cut(s) 34, 206
SfaNI GCATC 2 cut(s) 34, 124
SinI GGWCC 1 cut(s) 168
Sse9I AATT 2 cut(s) 138, 240
SspI AATATT 1 cut(s) 81
StyD4I CCNGG 1 cut(s) 182
TasI AATT 2 cut(s) 138, 240
TfiI GAWTC 1 cut(s) 215
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TseFI GTSAC 1 cut(s) 199
Tsp45I GTSAC 1 cut(s) 199
Van91I CCANNNNNTGG 1 cut(s) 35
VpaK11BI GGWCC 1 cut(s) 168
XapI RAATTY 1 cut(s) 240
XcmI CCANNNNNNNNNTGG 1 cut(s) 180
Zsp2I ATGCAT 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.