RchiOBHm_Chr5g0062981

Converts zeaxanthin into antheraxanthin and subsequently violaxanthin

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
68752368 .. 68755322
2955 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33914

Sequence Viewer

Length: 156 bp
ATGCAATGGTATACATTTCACAAGGAACTAGCTAGTGGTGTTGATGCCCACAATGGTAAAAAGGAAAGGTTGCTTAAAATATTTGATAGATGGTGTGATAATGTGGTAGATTTGCTACTTGCCAAGCACAGAGGAAGATGCAAGTCTACAACGTGA
Functional Annotation

Protein Analysis

51

Amino Acids

6.02

Weight (kDa)

9.44

Isoelectric Point (pI)

17.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 11, 146
AluBI AGCT 1 cut(s) 32
AluI AGCT 1 cut(s) 32
BccI CCATC 1 cut(s) 84
BfaI CTAG 2 cut(s) 29, 33
BmsI GCATC 2 cut(s) 34, 128
Bse3DI GCAATG 1 cut(s) 11
BseMI GCAATG 1 cut(s) 11
BsrDI GCAATG 1 cut(s) 11
BssNAI GTATAC 1 cut(s) 12
Bst1107I GTATAC 1 cut(s) 12
BstZ17I GTATAC 1 cut(s) 12
CviJI RGCY 1 cut(s) 32
CviKI_1 RGCY 1 cut(s) 32
FaiI YATR 1 cut(s) 12
FblI GTMKAC 2 cut(s) 11, 146
FspBI CTAG 2 cut(s) 29, 33
Hpy166II GTNNAC 2 cut(s) 12, 147
Hpy8I GTNNAC 2 cut(s) 12, 147
HpyCH4IV ACGT 1 cut(s) 152
HpyCH4V TGCA 2 cut(s) 4, 141
HpySE526I ACGT 1 cut(s) 152
LweI GCATC 2 cut(s) 34, 128
MaeI CTAG 2 cut(s) 29, 33
MaeII ACGT 1 cut(s) 152
MboII GAAGA 1 cut(s) 147
MnlI CCTC 1 cut(s) 125
MseI TTAA 1 cut(s) 75
SaqAI TTAA 1 cut(s) 75
SetI ASST 3 cut(s) 34, 71, 155
SfaNI GCATC 2 cut(s) 34, 128
SgeI CNNG 5 cut(s) 34, 41, 45, 131, 136
SspI AATATT 1 cut(s) 81
SspMI CTAG 2 cut(s) 29, 33
TaiI ACGT 1 cut(s) 155
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
XmiI GTMKAC 2 cut(s) 11, 146
XspI CTAG 2 cut(s) 29, 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.