RchiOBHm_Chr2g0163681

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
79067108 .. 79069410
2303 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGGAGGACACTGAACAGAATTTGGGAGATGAACTGGAAAATGCACAAAAGACACTGAATGCCAGTCAATCTCGCAGATCAGATGGCGACTCCAAAACAACCGCTGAAACTGGAGATGGCATAGCATCATCAAAGAAAGCTATACTAGACAAGTTAGAGGAGGGGAAAATAGATTTCGTTGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.54

Weight (kDa)

4.4

Isoelectric Point (pI)

50.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 102
AcsI RAATTY 1 cut(s) 19
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
ApoI RAATTY 1 cut(s) 19
BccI CCATC 2 cut(s) 77, 110
BfaI CTAG 1 cut(s) 146
BmsI GCATC 1 cut(s) 134
BpmI CTGGAG 1 cut(s) 132
Bse1I ACTGG 3 cut(s) 39, 63, 115
BseNI ACTGG 3 cut(s) 39, 63, 115
BseRI GAGGAG 1 cut(s) 173
BsmI GAATGC 1 cut(s) 64
Bsp143I GATC 1 cut(s) 77
BspACI CCGC 1 cut(s) 102
BsrI ACTGG 3 cut(s) 39, 63, 115
BssMI GATC 1 cut(s) 77
BstKTI GATC 1 cut(s) 80
BstMBI GATC 1 cut(s) 77
BtsIMutI CAGTG 2 cut(s) 9, 53
CviJI RGCY 1 cut(s) 140
CviKI_1 RGCY 1 cut(s) 140
DpnI GATC 1 cut(s) 79
DpnII GATC 1 cut(s) 77
FaiI YATR 2 cut(s) 122, 143
FspBI CTAG 1 cut(s) 146
GsuI CTGGAG 1 cut(s) 132
HinfI GANTC 1 cut(s) 89
Hpy188I TCNGA 1 cut(s) 82
HpyCH4V TGCA 1 cut(s) 44
Kzo9I GATC 1 cut(s) 77
LpnPI CCDG 3 cut(s) 20, 76, 96
LweI GCATC 1 cut(s) 134
MaeI CTAG 1 cut(s) 146
MalI GATC 1 cut(s) 79
MboI GATC 1 cut(s) 77
MluCI AATT 1 cut(s) 19
MlyI GAGTC 1 cut(s) 83
MnlI CCTC 2 cut(s) 151, 154
MspA1I CMGCKG 1 cut(s) 104
Mva1269I GAATGC 1 cut(s) 64
NdeII GATC 1 cut(s) 77
PctI GAATGC 1 cut(s) 64
PleI GAGTC 1 cut(s) 83
PpsI GAGTC 1 cut(s) 83
Sau3AI GATC 1 cut(s) 77
SchI GAGTC 1 cut(s) 83
SetI ASST 1 cut(s) 142
SfaNI GCATC 1 cut(s) 134
SgeI CNNG 6 cut(s) 47, 75, 84, 123, 158, 163
Sse9I AATT 1 cut(s) 19
SsiI CCGC 1 cut(s) 102
SspMI CTAG 1 cut(s) 146
TasI AATT 1 cut(s) 19
TscAI CASTG 2 cut(s) 16, 60
TspDTI ATGAA 1 cut(s) 45
TspRI CASTG 2 cut(s) 16, 60
XapI RAATTY 1 cut(s) 19
XspI CTAG 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.