RchiOBHm_Chr1g0314511

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
1773199 .. 1774542
1344 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 144 bp
ATGATGCTCATCTACAAATGCATTCCCAACAAAAGTTGTTACGTGTCCCCAGAATACACAATTGATGGGTTCTACTCGATAAAATCCAATGTCTACAGCTATGGAGTTTTGGTGTTAGAGATAGAGAGTGGGAAGAGAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

47

Amino Acids

5.42

Weight (kDa)

7.74

Isoelectric Point (pI)

58.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 93
AflIII ACRYGT 1 cut(s) 42
AluBI AGCT 1 cut(s) 99
AluI AGCT 1 cut(s) 99
BccI CCATC 1 cut(s) 59
BfmI CTRYAG 1 cut(s) 94
BsaAI YACGTR 1 cut(s) 43
BsaBI GATNNNNATC 1 cut(s) 8
BsaXI ACNNNNNCTCC 2 cut(s) 96, 126
Bse8I GATNNNNATC 1 cut(s) 8
BseJI GATNNNNATC 1 cut(s) 8
BslFI GGGAC 1 cut(s) 31
BsmFI GGGAC 1 cut(s) 31
BsmI GAATGC 1 cut(s) 21
Bst6I CTCTTC 1 cut(s) 128
BstBAI YACGTR 1 cut(s) 43
BstSFI CTRYAG 1 cut(s) 94
CviJI RGCY 1 cut(s) 99
CviKI_1 RGCY 1 cut(s) 99
Eam1104I CTCTTC 1 cut(s) 128
EarI CTCTTC 1 cut(s) 128
EcoT22I ATGCAT 1 cut(s) 23
FaiI YATR 1 cut(s) 102
FaqI GGGAC 1 cut(s) 31
FblI GTMKAC 1 cut(s) 93
Hpy166II GTNNAC 1 cut(s) 94
Hpy8I GTNNAC 1 cut(s) 94
HpyCH4IV ACGT 1 cut(s) 42
HpyCH4V TGCA 1 cut(s) 21
HpySE526I ACGT 1 cut(s) 42
LpnPI CCDG 1 cut(s) 63
MaeII ACGT 1 cut(s) 42
MaeIII GTNAC 1 cut(s) 38
MfeI CAATTG 1 cut(s) 60
MluCI AATT 1 cut(s) 60
Mph1103I ATGCAT 1 cut(s) 23
MunI CAATTG 1 cut(s) 60
Mva1269I GAATGC 1 cut(s) 21
NsiI ATGCAT 1 cut(s) 23
PctI GAATGC 1 cut(s) 21
Ppu21I YACGTR 1 cut(s) 43
SetI ASST 2 cut(s) 45, 101
SfcI CTRYAG 1 cut(s) 94
SgeI CNNG 3 cut(s) 55, 62, 88
Sse9I AATT 1 cut(s) 60
TaiI ACGT 1 cut(s) 45
TaqI TCGA 1 cut(s) 77
TasI AATT 1 cut(s) 60
XmiI GTMKAC 1 cut(s) 93
Zsp2I ATGCAT 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.