RchiOBHm_Chr1g0360701

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
52526097 .. 52526252
156 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 156 bp
ATGAGAAAGTTCAATGCTTGGCCCGTGTTCTTCAAGCGCGAGTGGAATCGGAACTGGCCTTTCCTCATCGGCTTCACCATCACTGGGATTCTCATCACCAAGTTCTCTCTCTATCTCACTGGGTACTCCACTCCATTTCTCTTTCTCATTCTGTGA

Protein Analysis

51

Amino Acids

6.21

Weight (kDa)

10.55

Isoelectric Point (pI)

23.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 39
AfaI GTAC 1 cut(s) 125
AfiI CCNNNNNNNGG 1 cut(s) 84
AgsI TTSAA 2 cut(s) 13, 34
AoxI GGCC 2 cut(s) 20, 56
AspLEI GCGC 1 cut(s) 39
AspS9I GGNCC 1 cut(s) 21
AsuHPI GGTGA 2 cut(s) 67, 88
BccI CCATC 1 cut(s) 86
BmgT120I GGNCC 1 cut(s) 21
BmrI ACTGGG 2 cut(s) 93, 129
BmuI ACTGGG 2 cut(s) 93, 129
BsaBI GATNNNNATC 1 cut(s) 92
Bsc4I CCNNNNNNNGG 1 cut(s) 84
Bse1I ACTGG 3 cut(s) 59, 88, 124
Bse8I GATNNNNATC 1 cut(s) 92
BseJI GATNNNNATC 1 cut(s) 92
BseLI CCNNNNNNNGG 1 cut(s) 84
BseNI ACTGG 3 cut(s) 59, 88, 124
Bsh1236I CGCG 1 cut(s) 39
BshFI GGCC 2 cut(s) 22, 58
BslI CCNNNNNNNGG 1 cut(s) 84
BsnI GGCC 2 cut(s) 22, 58
BspANI GGCC 2 cut(s) 22, 58
BspFNI CGCG 1 cut(s) 39
BsrI ACTGG 3 cut(s) 59, 88, 124
BstFNI CGCG 1 cut(s) 39
BstHHI GCGC 1 cut(s) 39
BstUI CGCG 1 cut(s) 39
BsuRI GGCC 2 cut(s) 22, 58
BtsIMutI CAGTG 2 cut(s) 81, 117
CfoI GCGC 1 cut(s) 39
Cfr13I GGNCC 1 cut(s) 21
Csp6I GTAC 1 cut(s) 124
CviJI RGCY 3 cut(s) 22, 58, 72
CviKI_1 RGCY 3 cut(s) 22, 58, 72
CviQI GTAC 1 cut(s) 124
GlaI GCGC 1 cut(s) 38
HaeIII GGCC 2 cut(s) 22, 58
HhaI GCGC 1 cut(s) 39
Hin6I GCGC 1 cut(s) 37
HinP1I GCGC 1 cut(s) 37
HinfI GANTC 2 cut(s) 46, 88
HphI GGTGA 2 cut(s) 67, 88
Hpy188I TCNGA 1 cut(s) 51
HspAI GCGC 1 cut(s) 37
LpnPI CCDG 3 cut(s) 40, 69, 105
MboII GAAGA 1 cut(s) 22
MnlI CCTC 1 cut(s) 74
MvnI CGCG 1 cut(s) 39
PfeI GAWTC 2 cut(s) 46, 88
PspPI GGNCC 1 cut(s) 21
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
Sau96I GGNCC 1 cut(s) 21
TfiI GAWTC 2 cut(s) 46, 88
TscAI CASTG 2 cut(s) 88, 124
TspRI CASTG 2 cut(s) 88, 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.