Rw5G037380

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
65793254 .. 65793409
156 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G037380.1

Sequence Viewer

Length: 156 bp
ATGAGAAAGTTCAATTCTTGGCTTGTGTTCTTCAAGCGTGAGTGGAATTGGAATTGGCCTTTCCTCATCGGCTTCGCTATCACCTGGATTCTCATCACCAAGTTCTCTCTCTGTCTCACTGGGTACTCCACTCCATTTCTCTTTCTCATTCTGTGA

Protein Analysis

51

Amino Acids

6.31

Weight (kDa)

10.03

Isoelectric Point (pI)

24.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 125
AgsI TTSAA 2 cut(s) 13, 34
AjnI CCWGG 1 cut(s) 83
Alw26I GTCTC 1 cut(s) 119
AoxI GGCC 1 cut(s) 56
AsuHPI GGTGA 2 cut(s) 73, 88
BciT130I CCWGG 1 cut(s) 85
BcoDI GTCTC 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 85
BmrFI CCNGG 1 cut(s) 85
BmrI ACTGGG 1 cut(s) 129
BmuI ACTGGG 1 cut(s) 129
BsaBI GATNNNNATC 1 cut(s) 92
Bse1I ACTGG 1 cut(s) 124
Bse8I GATNNNNATC 1 cut(s) 92
BseBI CCWGG 1 cut(s) 85
BseJI GATNNNNATC 1 cut(s) 92
BseNI ACTGG 1 cut(s) 124
BshFI GGCC 1 cut(s) 58
BsmAI GTCTC 1 cut(s) 119
BsnI GGCC 1 cut(s) 58
BspANI GGCC 1 cut(s) 58
BsrI ACTGG 1 cut(s) 124
Bst2UI CCWGG 1 cut(s) 85
BstMAI GTCTC 1 cut(s) 119
BstNI CCWGG 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 83
BsuRI GGCC 1 cut(s) 58
BtsIMutI CAGTG 1 cut(s) 117
Csp6I GTAC 1 cut(s) 124
CviJI RGCY 3 cut(s) 22, 58, 72
CviKI_1 RGCY 3 cut(s) 22, 58, 72
CviQI GTAC 1 cut(s) 124
EcoRII CCWGG 1 cut(s) 83
HaeIII GGCC 1 cut(s) 58
HinfI GANTC 1 cut(s) 88
HphI GGTGA 2 cut(s) 73, 88
LpnPI CCDG 3 cut(s) 70, 97, 105
MboII GAAGA 1 cut(s) 22
MluCI AATT 3 cut(s) 13, 46, 52
MnlI CCTC 1 cut(s) 74
MspR9I CCNGG 1 cut(s) 85
MvaI CCWGG 1 cut(s) 85
PfeI GAWTC 1 cut(s) 88
Psp6I CCWGG 1 cut(s) 83
PspGI CCWGG 1 cut(s) 83
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
ScrFI CCNGG 1 cut(s) 85
SetI ASST 1 cut(s) 86
SgeI CNNG 8 cut(s) 30, 35, 46, 50, 96, 97, 112, 132
Sse9I AATT 3 cut(s) 13, 46, 52
StyD4I CCNGG 1 cut(s) 83
TasI AATT 3 cut(s) 13, 46, 52
TfiI GAWTC 1 cut(s) 88
TscAI CASTG 1 cut(s) 124
TspRI CASTG 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.