Rmu_ssc0000309.1_g000040

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000309.1
Physical Location & Seq
Reverse (-)
152124 .. 153620
1497 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000309.1_g000040.1.cds

Sequence Viewer

Length: 243 bp
atgagccgcacaacacacccacaaacgcaaacacagaacagtctgagagagagagaagagcaagagaaggcagaaatgaggaagttcgatccatggccgattttcttcaagcgagaatggaaccggaactggcctttcctcgccgggttcgccataaccggagccctcatcaccaagttctctctcggcctcactgaggaagatgccaagaactcacccttcgttcagaggcacaagaggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.59

Weight (kDa)

9.98

Isoelectric Point (pI)

58.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 7
AclWI GGATC 1 cut(s) 83
AcoI YGGCCR 1 cut(s) 95
AfiI CCNNNNNNNGG 1 cut(s) 196
AgsI TTSAA 1 cut(s) 109
AlwI GGATC 1 cut(s) 83
AoxI GGCC 3 cut(s) 95, 131, 187
AsuC2I CCSGG 1 cut(s) 145
AsuHPI GGTGA 2 cut(s) 163, 207
BanII GRGCYC 1 cut(s) 166
BcnI CCSGG 1 cut(s) 145
BisI GCNGC 1 cut(s) 7
BlsI GCNGC 1 cut(s) 8
Bme1390I CCNGG 1 cut(s) 145
BmiI GGNNCC 2 cut(s) 122, 163
BmrFI CCNGG 1 cut(s) 145
BmsI GCATC 1 cut(s) 193
BpuMI CCSGG 1 cut(s) 145
BsaJI CCNNGG 1 cut(s) 92
BsaWI WCCGGW 2 cut(s) 123, 158
Bsc4I CCNNNNNNNGG 1 cut(s) 196
Bse1I ACTGG 1 cut(s) 134
BseDI CCNNGG 1 cut(s) 92
BseLI CCNNNNNNNGG 1 cut(s) 196
BseMII CTCAG 2 cut(s) 35, 186
BseNI ACTGG 1 cut(s) 134
BshFI GGCC 3 cut(s) 97, 133, 189
BsiSI CCGG 3 cut(s) 124, 144, 159
BslI CCNNNNNNNGG 1 cut(s) 196
BsnI GGCC 3 cut(s) 97, 133, 189
Bsp1286I GDGCHC 1 cut(s) 166
Bsp143I GATC 1 cut(s) 88
Bsp19I CCATGG 1 cut(s) 92
BspACI CCGC 1 cut(s) 7
BspANI GGCC 3 cut(s) 97, 133, 189
BspCNI CTCAG 2 cut(s) 36, 187
BspLI GGNNCC 2 cut(s) 122, 163
BspPI GGATC 1 cut(s) 83
BspQI GCTCTTC 1 cut(s) 51
BsrI ACTGG 1 cut(s) 134
BssECI CCNNGG 1 cut(s) 92
BssMI GATC 1 cut(s) 88
BssT1I CCWWGG 1 cut(s) 92
Bst4CI ACNGT 1 cut(s) 41
Bst6I CTCTTC 1 cut(s) 51
BstDEI CTNAG 2 cut(s) 44, 195
BstDSI CCRYGG 1 cut(s) 92
BstENI CCTNNNNNAGG 1 cut(s) 194
BstKTI GATC 1 cut(s) 91
BstMBI GATC 1 cut(s) 88
BstMWI GCNNNNNNNGC 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 143
BsuRI GGCC 3 cut(s) 97, 133, 189
BtgI CCRYGG 1 cut(s) 92
BtsIMutI CAGTG 1 cut(s) 192
CviAII CATG 1 cut(s) 93
CviJI RGCY 5 cut(s) 6, 97, 133, 164, 189
CviKI_1 RGCY 5 cut(s) 6, 97, 133, 164, 189
DdeI CTNAG 2 cut(s) 44, 195
DpnI GATC 1 cut(s) 90
DpnII GATC 1 cut(s) 88
EaeI YGGCCR 1 cut(s) 95
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco130I CCWWGG 1 cut(s) 92
Eco24I GRGCYC 1 cut(s) 166
EcoNI CCTNNNNNAGG 1 cut(s) 194
EcoT14I CCWWGG 1 cut(s) 92
EcoT38I GRGCYC 1 cut(s) 166
ErhI CCWWGG 1 cut(s) 92
FaeI CATG 1 cut(s) 96
FaiI YATR 2 cut(s) 94, 155
FatI CATG 1 cut(s) 92
Fnu4HI GCNGC 1 cut(s) 7
FriOI GRGCYC 1 cut(s) 166
Fsp4HI GCNGC 1 cut(s) 7
GluI GCNGC 1 cut(s) 7
HaeIII GGCC 3 cut(s) 97, 133, 189
HapII CCGG 3 cut(s) 124, 144, 159
Hin1II CATG 1 cut(s) 96
HpaII CCGG 3 cut(s) 124, 144, 159
HphI GGTGA 2 cut(s) 163, 207
Hpy188I TCNGA 2 cut(s) 45, 228
HpyAV CCTTC 2 cut(s) 61, 229
HpyCH4III ACNGT 1 cut(s) 41
HpyF10VI GCNNNNNNNGC 1 cut(s) 149
HpyF3I CTNAG 2 cut(s) 44, 195
Hsp92II CATG 1 cut(s) 96
Kzo9I GATC 1 cut(s) 88
LguI GCTCTTC 1 cut(s) 51
LmnI GCTCC 1 cut(s) 161
LpnPI CCDG 4 cut(s) 115, 137, 157, 172
LweI GCATC 1 cut(s) 193
MalI GATC 1 cut(s) 90
MboI GATC 1 cut(s) 88
MboII GAAGA 3 cut(s) 68, 97, 212
MhlI GDGCHC 1 cut(s) 166
MnlI CCTC 7 cut(s) 72, 149, 176, 190, 200, 222, 231
MspI CCGG 3 cut(s) 124, 144, 159
MspR9I CCNGG 1 cut(s) 145
MwoI GCNNNNNNNGC 1 cut(s) 149
NciI CCSGG 1 cut(s) 145
NcoI CCATGG 1 cut(s) 92
NdeII GATC 1 cut(s) 88
NlaIII CATG 1 cut(s) 96
NlaIV GGNNCC 2 cut(s) 122, 163
NmeAIII GCCGAG 1 cut(s) 165
PciSI GCTCTTC 1 cut(s) 51
PkrI GCNGC 1 cut(s) 8
PspN4I GGNNCC 2 cut(s) 122, 163
SapI GCTCTTC 1 cut(s) 51
SatI GCNGC 1 cut(s) 7
Sau3AI GATC 1 cut(s) 88
ScrFI CCNGG 1 cut(s) 145
SduI GDGCHC 1 cut(s) 166
SetI ASST 1 cut(s) 242
SfaNI GCATC 1 cut(s) 193
SsiI CCGC 1 cut(s) 7
StyD4I CCNGG 1 cut(s) 143
StyI CCWWGG 1 cut(s) 92
TaaI ACNGT 1 cut(s) 41
TaqI TCGA 1 cut(s) 87
TauI GCSGC 1 cut(s) 9
TscAI CASTG 1 cut(s) 199
TspRI CASTG 1 cut(s) 199
XagI CCTNNNNNAGG 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.