RchiOBHm_Chr7g0223231

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
44887822 .. 44888674
853 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19987

Sequence Viewer

Length: 135 bp
ATGAGAAAGTTCAATGCTTGGCCCGTGTTCTTCAAGCGCGAGTGGAATCGGAACTGGCCTTTCCTCATCGGCTTCCCCATCACCGGGATTCTCATCACCAAGTTCTCTCTCTGTCTCACTGGAGGAGGGTGCTAA

Protein Analysis

44

Amino Acids

5.16

Weight (kDa)

10.32

Isoelectric Point (pI)

33.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 39
AfiI CCNNNNNNNGG 2 cut(s) 83, 84
AgsI TTSAA 2 cut(s) 13, 34
Alw26I GTCTC 1 cut(s) 119
AoxI GGCC 2 cut(s) 20, 56
AspLEI GCGC 1 cut(s) 39
AspS9I GGNCC 1 cut(s) 21
AsuC2I CCSGG 1 cut(s) 85
AsuHPI GGTGA 2 cut(s) 73, 88
BccI CCATC 1 cut(s) 86
BcnI CCSGG 1 cut(s) 85
BcoDI GTCTC 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 85
BmgT120I GGNCC 1 cut(s) 21
BmrFI CCNGG 1 cut(s) 85
BpuMI CCSGG 1 cut(s) 85
BsaBI GATNNNNATC 1 cut(s) 92
Bsc4I CCNNNNNNNGG 2 cut(s) 83, 84
Bse1I ACTGG 2 cut(s) 59, 124
Bse8I GATNNNNATC 1 cut(s) 92
BseJI GATNNNNATC 1 cut(s) 92
BseLI CCNNNNNNNGG 2 cut(s) 83, 84
BseNI ACTGG 2 cut(s) 59, 124
Bsh1236I CGCG 1 cut(s) 39
BshFI GGCC 2 cut(s) 22, 58
BsiSI CCGG 1 cut(s) 84
BslI CCNNNNNNNGG 2 cut(s) 83, 84
BsmAI GTCTC 1 cut(s) 119
BsnI GGCC 2 cut(s) 22, 58
BspANI GGCC 2 cut(s) 22, 58
BspFNI CGCG 1 cut(s) 39
BsrI ACTGG 2 cut(s) 59, 124
BstFNI CGCG 1 cut(s) 39
BstHHI GCGC 1 cut(s) 39
BstMAI GTCTC 1 cut(s) 119
BstSCI CCNGG 1 cut(s) 83
BstUI CGCG 1 cut(s) 39
BsuRI GGCC 2 cut(s) 22, 58
BtsIMutI CAGTG 1 cut(s) 117
CfoI GCGC 1 cut(s) 39
Cfr13I GGNCC 1 cut(s) 21
CviJI RGCY 3 cut(s) 22, 58, 72
CviKI_1 RGCY 3 cut(s) 22, 58, 72
GlaI GCGC 1 cut(s) 38
HaeIII GGCC 2 cut(s) 22, 58
HapII CCGG 1 cut(s) 84
HhaI GCGC 1 cut(s) 39
Hin6I GCGC 1 cut(s) 37
HinP1I GCGC 1 cut(s) 37
HinfI GANTC 2 cut(s) 46, 88
HpaII CCGG 1 cut(s) 84
HphI GGTGA 2 cut(s) 73, 88
Hpy188I TCNGA 1 cut(s) 51
HspAI GCGC 1 cut(s) 37
LpnPI CCDG 3 cut(s) 40, 97, 105
MboII GAAGA 1 cut(s) 22
MnlI CCTC 3 cut(s) 74, 116, 119
MspI CCGG 1 cut(s) 84
MspR9I CCNGG 1 cut(s) 85
MvnI CGCG 1 cut(s) 39
NciI CCSGG 1 cut(s) 85
PfeI GAWTC 2 cut(s) 46, 88
PspPI GGNCC 1 cut(s) 21
Sau96I GGNCC 1 cut(s) 21
ScrFI CCNGG 1 cut(s) 85
StyD4I CCNGG 1 cut(s) 83
TfiI GAWTC 2 cut(s) 46, 88
TscAI CASTG 1 cut(s) 124
TspRI CASTG 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.