RchiOBHm_Chr1g0337951

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
29912458 .. 29912808
351 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56581

Sequence Viewer

Length: 219 bp
ATGTTGATCAAATATCTATCCATGATATATTTGAAATATGTGAAGGTGTTATGTGAAATTGATCAATATCTATCCATGATATATTTGAAATATGTGAAATTGATCAAATATCTATCCATGATATATTTTGAATATGTGAGGGTGTTGGTAAAAAGAAAATCAAGCATGCATTGCTTTAATGTTATTTCACATATTAATGATGCAATATTTGCTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.76

Weight (kDa)

9.28

Isoelectric Point (pI)

23.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 34, 88, 131
AseI ATTAAT 1 cut(s) 195
BclI TGATCA 3 cut(s) 6, 61, 102
BmsI GCATC 1 cut(s) 190
BsaBI GATNNNNATC 1 cut(s) 66
Bse3DI GCAATG 1 cut(s) 169
Bse8I GATNNNNATC 1 cut(s) 66
BseJI GATNNNNATC 1 cut(s) 66
BseMI GCAATG 1 cut(s) 169
Bsp143I GATC 3 cut(s) 6, 61, 102
BsrDI GCAATG 1 cut(s) 169
BssMI GATC 3 cut(s) 6, 61, 102
BstAPI GCANNNNNTGC 2 cut(s) 171, 209
BstC8I GCNNGC 1 cut(s) 167
BstKTI GATC 3 cut(s) 9, 64, 105
BstMBI GATC 3 cut(s) 6, 61, 102
BstMWI GCNNNNNNNGC 2 cut(s) 171, 209
BstNSI RCATGY 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 167
CviAII CATG 4 cut(s) 22, 76, 118, 166
DpnI GATC 3 cut(s) 8, 63, 104
DpnII GATC 3 cut(s) 6, 61, 102
EcoT22I ATGCAT 1 cut(s) 171
FaeI CATG 4 cut(s) 25, 79, 121, 169
FatI CATG 4 cut(s) 21, 75, 117, 165
FbaI TGATCA 3 cut(s) 6, 61, 102
FspEI CC 7 cut(s) 29, 34, 88, 124, 125, 130, 131
Hin1II CATG 4 cut(s) 25, 79, 121, 169
HpyAV CCTTC 1 cut(s) 37
HpyCH4V TGCA 2 cut(s) 169, 203
HpyF10VI GCNNNNNNNGC 2 cut(s) 171, 209
Hsp92II CATG 4 cut(s) 25, 79, 121, 169
Ksp22I TGATCA 3 cut(s) 6, 61, 102
Kzo9I GATC 3 cut(s) 6, 61, 102
LweI GCATC 1 cut(s) 190
MalI GATC 3 cut(s) 8, 63, 104
MboI GATC 3 cut(s) 6, 61, 102
MluCI AATT 2 cut(s) 57, 98
MnlI CCTC 1 cut(s) 132
Mph1103I ATGCAT 1 cut(s) 171
MseI TTAA 2 cut(s) 177, 195
MslI CAYNNNNRTG 1 cut(s) 195
MwoI GCNNNNNNNGC 2 cut(s) 171, 209
NdeII GATC 3 cut(s) 6, 61, 102
NlaIII CATG 4 cut(s) 25, 79, 121, 169
NsiI ATGCAT 1 cut(s) 171
NspI RCATGY 1 cut(s) 169
PaeI GCATGC 1 cut(s) 169
PshBI ATTAAT 1 cut(s) 195
RseI CAYNNNNRTG 1 cut(s) 195
SaqAI TTAA 2 cut(s) 177, 195
Sau3AI GATC 3 cut(s) 6, 61, 102
SetI ASST 1 cut(s) 48
SfaNI GCATC 1 cut(s) 190
SgeI CNNG 5 cut(s) 34, 88, 130, 174, 178
SmiMI CAYNNNNRTG 1 cut(s) 195
SphI GCATGC 1 cut(s) 169
Sse9I AATT 2 cut(s) 57, 98
SspI AATATT 1 cut(s) 207
TasI AATT 2 cut(s) 57, 98
Tru1I TTAA 2 cut(s) 177, 195
Tru9I TTAA 2 cut(s) 177, 195
VspI ATTAAT 1 cut(s) 195
XceI RCATGY 1 cut(s) 169
Zsp2I ATGCAT 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.