Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000001

Orthogroup ID

OG0006422

Physical Location & Seq

Genomic Coordinates Forward (+)

53115484 .. 53121943

Gene Structure 6460 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_1G00036370.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 510 bp

ATGGCGGTGTTGAGAGAGCGAGCGCAGAGAGACCCGAAGAAGGATCTATCTTACAACAAGGGCCTGACAGGACCACTCCCAGCAGAAATTGGGAGTTTGAAGAAGCTATCTAACATGTCTCTGAACTCTGGGAGGATACCATCTTCTATTGGTAGTCTGTCTAGACTATATTGGCTGGATCTAGCTGACAACAACCTTGAAGGACCCATCCCAGTCTCTGATAGTGGTGAACCTGGTCTTGACATTCTCAGTCATTGCAAGCACTTGTATAAACATGTTAACTGGGCCTATTCCTCTGAGCCTCTACAGTCTTACAAATGTCTCTCAGCTGTGAGTAGATTAAAACCTTGCCAGATATTACTTTATACTGTTTCAGGAGAGTTGTTACCGTTCATTATGAAGAACCTTATAGAGGCCTCTGGTGATCATATTCTTAGATTCTTGTCTAATAACAAGCTAAGCGGCCCTGCTCCCAACCTTACTGGCATGAACCTTCTCCATTATGTGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 Pkinase Pkinase_Tyr

Protein Analysis

169

Amino Acids

18.64

Weight (kDa)

8.97

Isoelectric Point (pI)

46.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006422)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0325521 RchiOBHm_Chr1g0337951 RchiOBHm_Chr2g0166631 RchiOBHm_Chr3g0479841 RchiOBHm_Chr4g0392621 RchiOBHm_Chr4g0397291 RchiOBHm_Chr4g0400561 RchiOBHm_Chr4g0418031 RchiOBHm_Chr5g0048041 RchiOBHm_Chr5g0079221 RchiOBHm_Chr6g0251371 RchiOBHm_Chr6g0257241 RchiOBHm_Chr7g0222971 RchiOBHm_Chr7g0241581
rosa_laevigata	RLG00000034139
rosa_multiflora	Rmu_sc0001029.1_g000028 Rmu_sc0002286.1_g000013
rosa_roxburghii	Rroxscaffold_1G00036370 Rroxscaffold_5G00354060 Rroxscaffold_7G00195570
rosa_samantha	Rh4AG016700 Rh4CG000200 Rh5AG299800 Rh5DG316500 Rh6AG127600 Rh7AG017800
rosa_wichuraiana	Rw3G019640

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	5, 462
AclWI	GGATC	2 cut(s)	51, 186
AfiI	CCNNNNNNNGG	2 cut(s)	40, 412
AflIII	ACRYGT	2 cut(s)	114, 274
AgsI	TTSAA	2 cut(s)	100, 200
AjnI	CCWGG	1 cut(s)	232
AluBI	AGCT	4 cut(s)	106, 185, 329, 457
AluI	AGCT	4 cut(s)	106, 185, 329, 457
Alw26I	GTCTC	4 cut(s)	24, 123, 220, 326
AlwI	GGATC	2 cut(s)	51, 186
AlwNI	CAGNNNCTG	1 cut(s)	218
AoxI	GGCC	4 cut(s)	61, 285, 414, 463
AspLEI	GCGC	1 cut(s)	25
AspS9I	GGNCC	5 cut(s)	61, 71, 203, 285, 464
AsuHPI	GGTGA	2 cut(s)	239, 434
AvaII	GGWCC	2 cut(s)	71, 203
BccI	CCATC	2 cut(s)	148, 215
BciT130I	CCWGG	1 cut(s)	234
BciVI	GTATCC	1 cut(s)	129
BclI	TGATCA	1 cut(s)	424
BcoDI	GTCTC	4 cut(s)	24, 123, 220, 326
BfaI	CTAG	2 cut(s)	162, 182
BfmI	CTRYAG	1 cut(s)	305
BfuI	GTATCC	1 cut(s)	129
BisI	GCNGC	1 cut(s)	463
BlpI	GCTNAGC	1 cut(s)	458
BlsI	GCNGC	1 cut(s)	464
Bme1390I	CCNGG	1 cut(s)	234
Bme18I	GGWCC	2 cut(s)	71, 203
BmgT120I	GGNCC	5 cut(s)	61, 71, 203, 285, 464
BmiI	GGNNCC	1 cut(s)	205
BmrFI	CCNGG	1 cut(s)	234
BmrI	ACTGGG	2 cut(s)	206, 292
BmuI	ACTGGG	2 cut(s)	206, 292
Bpu1102I	GCTNAGC	1 cut(s)	458
BsaI	GGTCTC	1 cut(s)	24
Bsc4I	CCNNNNNNNGG	2 cut(s)	40, 412
Bse1I	ACTGG	3 cut(s)	212, 287, 487
Bse3DI	GCAATG	1 cut(s)	253
BseBI	CCWGG	1 cut(s)	234
BseGI	GGATG	1 cut(s)	207
BseLI	CCNNNNNNNGG	2 cut(s)	40, 412
BseMI	GCAATG	1 cut(s)	253
BseMII	CTCAG	3 cut(s)	262, 288, 339
BseNI	ACTGG	3 cut(s)	212, 287, 487
BseYI	CCCAGC	1 cut(s)	79
BshFI	GGCC	4 cut(s)	63, 287, 416, 465
BslI	CCNNNNNNNGG	2 cut(s)	40, 412
BsmAI	GTCTC	4 cut(s)	24, 123, 220, 326
BsnI	GGCC	4 cut(s)	63, 287, 416, 465
Bso31I	GGTCTC	1 cut(s)	24
Bsp143I	GATC	3 cut(s)	43, 178, 424
Bsp1720I	GCTNAGC	1 cut(s)	458
BspACI	CCGC	2 cut(s)	5, 462
BspANI	GGCC	4 cut(s)	63, 287, 416, 465
BspCNI	CTCAG	3 cut(s)	261, 289, 338
BspLI	GGNNCC	1 cut(s)	205
BspPI	GGATC	2 cut(s)	51, 186
BspTNI	GGTCTC	1 cut(s)	24
BsrDI	GCAATG	1 cut(s)	253
BsrI	ACTGG	3 cut(s)	212, 287, 487
BssMI	GATC	3 cut(s)	43, 178, 424
Bst2UI	CCWGG	1 cut(s)	234
Bst4CI	ACNGT	3 cut(s)	309, 370, 390
BstC8I	GCNNGC	2 cut(s)	21, 260
BstDEI	CTNAG	5 cut(s)	248, 297, 325, 434, 458
BstENI	CCTNNNNNAGG	1 cut(s)	410
BstF5I	GGATG	1 cut(s)	207
BstHHI	GCGC	1 cut(s)	25
BstKTI	GATC	3 cut(s)	46, 181, 427
BstMAI	GTCTC	4 cut(s)	24, 123, 220, 326
BstMBI	GATC	3 cut(s)	43, 178, 424
BstNI	CCWGG	1 cut(s)	234
BstNSI	RCATGY	2 cut(s)	118, 278
BstSCI	CCNGG	1 cut(s)	232
BstSFI	CTRYAG	1 cut(s)	305
BstX2I	RGATCY	2 cut(s)	43, 178
BstYI	RGATCY	2 cut(s)	43, 178
BsuI	GTATCC	1 cut(s)	129
BsuRI	GGCC	4 cut(s)	63, 287, 416, 465
BtsCI	GGATG	1 cut(s)	207
Cac8I	GCNNGC	2 cut(s)	21, 260
CaiI	CAGNNNCTG	1 cut(s)	218
CfoI	GCGC	1 cut(s)	25
Cfr13I	GGNCC	5 cut(s)	61, 71, 203, 285, 464
CsiI	ACCWGGT	1 cut(s)	232
CviAII	CATG	3 cut(s)	115, 275, 487
DdeI	CTNAG	5 cut(s)	248, 297, 325, 434, 458
DpnI	GATC	3 cut(s)	45, 180, 426
DpnII	GATC	3 cut(s)	43, 178, 424
Eco147I	AGGCCT	1 cut(s)	416
Eco31I	GGTCTC	1 cut(s)	24
Eco47I	GGWCC	2 cut(s)	71, 203
EcoNI	CCTNNNNNAGG	1 cut(s)	410
EcoO109I	RGGNCCY	2 cut(s)	61, 203
EcoRII	CCWGG	1 cut(s)	232
FaeI	CATG	3 cut(s)	118, 278, 490
FatI	CATG	3 cut(s)	114, 274, 486
FbaI	TGATCA	1 cut(s)	424
Fnu4HI	GCNGC	1 cut(s)	463
FokI	GGATG	1 cut(s)	194
Fsp4HI	GCNGC	1 cut(s)	463
FspBI	CTAG	2 cut(s)	162, 182
GlaI	GCGC	1 cut(s)	24
GluI	GCNGC	1 cut(s)	463
GsaI	CCCAGC	1 cut(s)	83
HaeIII	GGCC	4 cut(s)	63, 287, 416, 465
HhaI	GCGC	1 cut(s)	25
Hin1II	CATG	3 cut(s)	118, 278, 490
Hin6I	GCGC	1 cut(s)	23
HinP1I	GCGC	1 cut(s)	23
HincII	GTYRAC	1 cut(s)	280
HindII	GTYRAC	1 cut(s)	280
HinfI	GANTC	1 cut(s)	438
HpaI	GTTAAC	1 cut(s)	280
HphI	GGTGA	2 cut(s)	239, 434
Hpy166II	GTNNAC	2 cut(s)	230, 280
Hpy188I	TCNGA	3 cut(s)	123, 220, 298
Hpy188III	TCNNGA	3 cut(s)	162, 239, 375
Hpy8I	GTNNAC	2 cut(s)	230, 280
HpyAV	CCTTC	3 cut(s)	34, 194, 503
HpyCH4III	ACNGT	3 cut(s)	309, 370, 390
HpyCH4V	TGCA	1 cut(s)	258
HpyF3I	CTNAG	5 cut(s)	248, 297, 325, 434, 458
Hsp92II	CATG	3 cut(s)	118, 278, 490
HspAI	GCGC	1 cut(s)	23
Ksp22I	TGATCA	1 cut(s)	424
KspAI	GTTAAC	1 cut(s)	280
Kzo9I	GATC	3 cut(s)	43, 178, 424
LmnI	GCTCC	1 cut(s)	475
MabI	ACCWGGT	1 cut(s)	232
MaeI	CTAG	2 cut(s)	162, 182
MaeIII	GTNAC	1 cut(s)	384
MalI	GATC	3 cut(s)	45, 180, 426
MboI	GATC	3 cut(s)	43, 178, 424
MboII	GAAGA	4 cut(s)	49, 112, 135, 412
MflI	RGATCY	2 cut(s)	43, 178
MluCI	AATT	1 cut(s)	87
MnlI	CCTC	5 cut(s)	126, 304, 312, 406, 427
MseI	TTAA	2 cut(s)	279, 341
MspA1I	CMGCKG	1 cut(s)	329
MspR9I	CCNGG	1 cut(s)	234
MvaI	CCWGG	1 cut(s)	234
NdeII	GATC	3 cut(s)	43, 178, 424
NlaIII	CATG	3 cut(s)	118, 278, 490
NlaIV	GGNNCC	1 cut(s)	205
NspI	RCATGY	2 cut(s)	118, 278
PceI	AGGCCT	1 cut(s)	416
PciI	ACATGT	2 cut(s)	114, 274
PfeI	GAWTC	1 cut(s)	438
PkrI	GCNGC	1 cut(s)	464
PpuMI	RGGWCCY	1 cut(s)	203
PscI	ACATGT	2 cut(s)	114, 274
Psp5II	RGGWCCY	1 cut(s)	203
Psp6I	CCWGG	1 cut(s)	232
PspFI	CCCAGC	1 cut(s)	79
PspGI	CCWGG	1 cut(s)	232
PspN4I	GGNNCC	1 cut(s)	205
PspPI	GGNCC	5 cut(s)	61, 71, 203, 285, 464
PspPPI	RGGWCCY	1 cut(s)	203
PstNI	CAGNNNCTG	1 cut(s)	218
PsuI	RGATCY	2 cut(s)	43, 178
PvuII	CAGCTG	1 cut(s)	329
SaqAI	TTAA	2 cut(s)	279, 341
SatI	GCNGC	1 cut(s)	463
Sau3AI	GATC	3 cut(s)	43, 178, 424
Sau96I	GGNCC	5 cut(s)	61, 71, 203, 285, 464
ScrFI	CCNGG	1 cut(s)	234
SexAI	ACCWGGT	1 cut(s)	232
SfcI	CTRYAG	1 cut(s)	305
SinI	GGWCC	2 cut(s)	71, 203
Sse9I	AATT	1 cut(s)	87
SseBI	AGGCCT	1 cut(s)	416
SsiI	CCGC	2 cut(s)	5, 462
SspMI	CTAG	2 cut(s)	162, 182
StuI	AGGCCT	1 cut(s)	416
StyD4I	CCNGG	1 cut(s)	232
TaaI	ACNGT	3 cut(s)	309, 370, 390
TasI	AATT	1 cut(s)	87
TauI	GCSGC	1 cut(s)	465
TfiI	GAWTC	1 cut(s)	438
Tru1I	TTAA	2 cut(s)	279, 341
Tru9I	TTAA	2 cut(s)	279, 341
TspDTI	ATGAA	3 cut(s)	382, 413, 503
VpaK11BI	GGWCC	2 cut(s)	71, 203
XagI	CCTNNNNNAGG	1 cut(s)	410
XbaI	TCTAGA	1 cut(s)	161
XceI	RCATGY	2 cut(s)	118, 278
XspI	CTAG	2 cut(s)	162, 182

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.