Rmu_sc0001029.1_g000028

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001029.1
OG0006422
Physical Location & Seq
Reverse (-)
106689 .. 108315
1627 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001029.1_g000028.1.cds

Sequence Viewer

Length: 261 bp
atgctagttaggaaagtggttgggcttgatgatatgaagaggagcagcctggccccgacaccattggcgggggtcggcggctgctctgaccctaactccggcagccctttccggccacctccgggggtccttcttgtttactcatacgagctatcaaagcttaccgggtttggtgttgttgcaatcccggtacactatacaaattgtgtagcgggtaatcctgcaggtcaggaggatcatggcggagatcgtgcgggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

8.82

Weight (kDa)

6.7

Isoelectric Point (pI)

39.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 215
AciI CCGC 5 cut(s) 68, 78, 212, 243, 254
AclWI GGATC 1 cut(s) 243
AcoI YGGCCR 1 cut(s) 113
AfaI GTAC 1 cut(s) 192
AfiI CCNNNNNNNGG 3 cut(s) 68, 98, 122
AjnI CCWGG 1 cut(s) 48
AluBI AGCT 2 cut(s) 151, 160
AluI AGCT 2 cut(s) 151, 160
AlwI GGATC 1 cut(s) 243
AoxI GGCC 2 cut(s) 51, 113
ApeKI GCWGC 3 cut(s) 45, 81, 102
AspS9I GGNCC 2 cut(s) 52, 127
AsuC2I CCSGG 3 cut(s) 123, 166, 188
AvaII GGWCC 1 cut(s) 127
BbvI GCAGC 3 cut(s) 57, 68, 114
BciT130I CCWGG 1 cut(s) 50
BcnI CCSGG 3 cut(s) 123, 166, 188
BfaI CTAG 1 cut(s) 5
BfmI CTRYAG 1 cut(s) 222
BfuAI ACCTGC 1 cut(s) 215
BisI GCNGC 4 cut(s) 46, 79, 82, 103
BlsI GCNGC 4 cut(s) 47, 80, 83, 104
Bme1390I CCNGG 4 cut(s) 50, 123, 166, 188
Bme18I GGWCC 1 cut(s) 127
BmgT120I GGNCC 2 cut(s) 52, 127
BmiI GGNNCC 2 cut(s) 54, 128
BmrFI CCNGG 4 cut(s) 50, 123, 166, 188
BpuMI CCSGG 3 cut(s) 123, 166, 188
BsaJI CCNNGG 1 cut(s) 122
BsaXI ACNNNNNCTCC 2 cut(s) 80, 110
Bsc4I CCNNNNNNNGG 3 cut(s) 68, 98, 122
BseBI CCWGG 1 cut(s) 50
BseDI CCNNGG 1 cut(s) 122
BseLI CCNNNNNNNGG 3 cut(s) 68, 98, 122
BseRI GAGGAG 1 cut(s) 55
BseXI GCAGC 3 cut(s) 57, 68, 114
BshFI GGCC 2 cut(s) 53, 115
BsiSI CCGG 5 cut(s) 99, 112, 122, 165, 188
BslI CCNNNNNNNGG 3 cut(s) 68, 98, 122
BsnI GGCC 2 cut(s) 53, 115
Bsp143I GATC 2 cut(s) 235, 247
BspACI CCGC 5 cut(s) 68, 78, 212, 243, 254
BspANI GGCC 2 cut(s) 53, 115
BspLI GGNNCC 2 cut(s) 54, 128
BspMAI CTGCAG 1 cut(s) 226
BspMI ACCTGC 1 cut(s) 215
BspPI GGATC 1 cut(s) 243
BssECI CCNNGG 1 cut(s) 122
BssMI GATC 2 cut(s) 235, 247
Bst2UI CCWGG 1 cut(s) 50
Bst6I CTCTTC 1 cut(s) 32
BstKTI GATC 2 cut(s) 238, 250
BstMBI GATC 2 cut(s) 235, 247
BstMWI GCNNNNNNNGC 1 cut(s) 157
BstNI CCWGG 1 cut(s) 50
BstSCI CCNGG 4 cut(s) 48, 121, 164, 186
BstSFI CTRYAG 1 cut(s) 222
BstV1I GCAGC 3 cut(s) 57, 68, 114
BsuRI GGCC 2 cut(s) 53, 115
BveI ACCTGC 1 cut(s) 215
Cfr13I GGNCC 2 cut(s) 52, 127
Csp6I GTAC 1 cut(s) 191
CviAII CATG 1 cut(s) 239
CviJI RGCY 8 cut(s) 25, 48, 53, 81, 105, 115, 151, 160
CviKI_1 RGCY 8 cut(s) 25, 48, 53, 81, 105, 115, 151, 160
CviQI GTAC 1 cut(s) 191
DpnI GATC 2 cut(s) 237, 249
DpnII GATC 2 cut(s) 235, 247
EaeI YGGCCR 1 cut(s) 113
Eam1104I CTCTTC 1 cut(s) 32
EarI CTCTTC 1 cut(s) 32
EciI GGCGGA 1 cut(s) 258
Eco47I GGWCC 1 cut(s) 127
EcoO109I RGGNCCY 1 cut(s) 127
EcoRII CCWGG 1 cut(s) 48
FaeI CATG 1 cut(s) 242
FaiI YATR 4 cut(s) 35, 145, 198, 240
FatI CATG 1 cut(s) 238
FauI CCCGC 3 cut(s) 61, 205, 247
Fnu4HI GCNGC 4 cut(s) 46, 79, 82, 103
Fsp4HI GCNGC 4 cut(s) 46, 79, 82, 103
FspBI CTAG 1 cut(s) 5
GluI GCNGC 4 cut(s) 46, 79, 82, 103
HaeIII GGCC 2 cut(s) 53, 115
HapII CCGG 5 cut(s) 99, 112, 122, 165, 188
Hin1II CATG 1 cut(s) 242
HindIII AAGCTT 1 cut(s) 158
HpaII CCGG 5 cut(s) 99, 112, 122, 165, 188
Hpy166II GTNNAC 2 cut(s) 139, 193
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 230
Hpy8I GTNNAC 2 cut(s) 139, 193
HpyAV CCTTC 1 cut(s) 140
HpyCH4V TGCA 2 cut(s) 182, 224
HpyF10VI GCNNNNNNNGC 1 cut(s) 157
Hsp92II CATG 1 cut(s) 242
Kzo9I GATC 2 cut(s) 235, 247
LmnI GCTCC 1 cut(s) 42
Lsp1109I GCAGC 3 cut(s) 57, 68, 114
MaeI CTAG 1 cut(s) 5
MalI GATC 2 cut(s) 237, 249
MboI GATC 2 cut(s) 235, 247
MboII GAAGA 1 cut(s) 49
MluCI AATT 1 cut(s) 202
MnlI CCTC 3 cut(s) 33, 129, 226
MspI CCGG 5 cut(s) 99, 112, 122, 165, 188
MspR9I CCNGG 4 cut(s) 50, 123, 166, 188
MvaI CCWGG 1 cut(s) 50
MwoI GCNNNNNNNGC 1 cut(s) 157
NciI CCSGG 3 cut(s) 123, 166, 188
NdeII GATC 2 cut(s) 235, 247
NlaIII CATG 1 cut(s) 242
NlaIV GGNNCC 2 cut(s) 54, 128
PkrI GCNGC 4 cut(s) 47, 80, 83, 104
PpuMI RGGWCCY 1 cut(s) 127
Psp5II RGGWCCY 1 cut(s) 127
Psp6I CCWGG 1 cut(s) 48
PspGI CCWGG 1 cut(s) 48
PspN4I GGNNCC 2 cut(s) 54, 128
PspPI GGNCC 2 cut(s) 52, 127
PspPPI RGGWCCY 1 cut(s) 127
PstI CTGCAG 1 cut(s) 226
RsaI GTAC 1 cut(s) 192
RsaNI GTAC 1 cut(s) 191
SatI GCNGC 4 cut(s) 46, 79, 82, 103
Sau3AI GATC 2 cut(s) 235, 247
Sau96I GGNCC 2 cut(s) 52, 127
SbfI CCTGCAGG 1 cut(s) 226
ScrFI CCNGG 4 cut(s) 50, 123, 166, 188
SdaI CCTGCAGG 1 cut(s) 226
SetI ASST 4 cut(s) 121, 153, 162, 229
SfcI CTRYAG 1 cut(s) 222
SinI GGWCC 1 cut(s) 127
Sse8387I CCTGCAGG 1 cut(s) 226
Sse9I AATT 1 cut(s) 202
SsiI CCGC 5 cut(s) 68, 78, 212, 243, 254
SspMI CTAG 1 cut(s) 5
StyD4I CCNGG 4 cut(s) 48, 121, 164, 186
TasI AATT 1 cut(s) 202
TauI GCSGC 1 cut(s) 81
TseI GCWGC 3 cut(s) 45, 81, 102
TspDTI ATGAA 1 cut(s) 50
VpaK11BI GGWCC 1 cut(s) 127
XspI CTAG 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.