RchiOBHm_Chr3g0479841

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
25631231 .. 25631690
460 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44490

Sequence Viewer

Length: 156 bp
ATGATATATTTTGAATATGTGAAGGTGTTAGTGAAATTGATCAAATATCTATCCATGATATATTTTGAATATGTGAAGGTGTTGGTAAAAAGAAAATCAAGCATGCATTGCTTTAATGTTATTTCACATATTAATGATGCAATATTTGTTGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

6.12

Weight (kDa)

9.42

Isoelectric Point (pI)

29.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 14, 68
AseI ATTAAT 1 cut(s) 132
BclI TGATCA 1 cut(s) 39
BmsI GCATC 1 cut(s) 127
Bse3DI GCAATG 1 cut(s) 106
BseMI GCAATG 1 cut(s) 106
Bsp143I GATC 1 cut(s) 39
BsrDI GCAATG 1 cut(s) 106
BssMI GATC 1 cut(s) 39
BstAPI GCANNNNNTGC 1 cut(s) 108
BstC8I GCNNGC 1 cut(s) 104
BstKTI GATC 1 cut(s) 42
BstMBI GATC 1 cut(s) 39
BstMWI GCNNNNNNNGC 1 cut(s) 108
BstNSI RCATGY 1 cut(s) 106
Cac8I GCNNGC 1 cut(s) 104
CviAII CATG 2 cut(s) 55, 103
DpnI GATC 1 cut(s) 41
DpnII GATC 1 cut(s) 39
EcoT22I ATGCAT 1 cut(s) 108
FaeI CATG 2 cut(s) 58, 106
FaiI YATR 7 cut(s) 7, 18, 56, 61, 72, 104, 129
FatI CATG 2 cut(s) 54, 102
FbaI TGATCA 1 cut(s) 39
FspEI CC 5 cut(s) 8, 62, 67, 68, 135
Hin1II CATG 2 cut(s) 58, 106
HpyAV CCTTC 2 cut(s) 16, 70
HpyCH4V TGCA 2 cut(s) 106, 140
HpyF10VI GCNNNNNNNGC 1 cut(s) 108
Hsp92II CATG 2 cut(s) 58, 106
Ksp22I TGATCA 1 cut(s) 39
Kzo9I GATC 1 cut(s) 39
LweI GCATC 1 cut(s) 127
MalI GATC 1 cut(s) 41
MboI GATC 1 cut(s) 39
MluCI AATT 1 cut(s) 35
Mph1103I ATGCAT 1 cut(s) 108
MseI TTAA 2 cut(s) 114, 132
MslI CAYNNNNRTG 1 cut(s) 132
MwoI GCNNNNNNNGC 1 cut(s) 108
NdeII GATC 1 cut(s) 39
NlaIII CATG 2 cut(s) 58, 106
NsiI ATGCAT 1 cut(s) 108
NspI RCATGY 1 cut(s) 106
PaeI GCATGC 1 cut(s) 106
PshBI ATTAAT 1 cut(s) 132
RseI CAYNNNNRTG 1 cut(s) 132
SaqAI TTAA 2 cut(s) 114, 132
Sau3AI GATC 1 cut(s) 39
SetI ASST 2 cut(s) 27, 81
SfaNI GCATC 1 cut(s) 127
SgeI CNNG 3 cut(s) 67, 111, 115
SmiMI CAYNNNNRTG 1 cut(s) 132
SphI GCATGC 1 cut(s) 106
Sse9I AATT 1 cut(s) 35
SspI AATATT 1 cut(s) 144
TasI AATT 1 cut(s) 35
Tru1I TTAA 2 cut(s) 114, 132
Tru9I TTAA 2 cut(s) 114, 132
VspI ATTAAT 1 cut(s) 132
XceI RCATGY 1 cut(s) 106
Zsp2I ATGCAT 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.