RchiOBHm_Chr1g0343831

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0004833
Physical Location & Seq
Reverse (-)
36118494 .. 36119216
723 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57033

Sequence Viewer

Length: 162 bp
ATGATGCCATTGTCGCGAACGACGAGTTGTGCGTCGCGCCCTTCATCAATGGCGGAGTCTCTGGTATGCTCGCTACCTCTGTCATCCAACCCATCGATACGATCAAGTGCTGAGAAGGCTGGGAGTGAAGAGCATGGAGATAAAGAAACCAAAGCAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.54

Weight (kDa)

6.53

Isoelectric Point (pI)

74.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 16, 37
AciI CCGC 1 cut(s) 53
Alw26I GTCTC 1 cut(s) 63
AspLEI GCGC 1 cut(s) 39
BccI CCATC 1 cut(s) 100
BcoDI GTCTC 1 cut(s) 63
Bsa29I ATCGAT 1 cut(s) 95
BseCI ATCGAT 1 cut(s) 95
BseGI GGATG 1 cut(s) 83
BseMII CTCAG 1 cut(s) 102
BseYI CCCAGC 1 cut(s) 119
Bsh1236I CGCG 2 cut(s) 16, 37
BshVI ATCGAT 1 cut(s) 95
BsmAI GTCTC 1 cut(s) 63
Bsp143I GATC 1 cut(s) 101
Bsp68I TCGCGA 1 cut(s) 16
BspACI CCGC 1 cut(s) 53
BspCNI CTCAG 1 cut(s) 103
BspDI ATCGAT 1 cut(s) 95
BspFNI CGCG 2 cut(s) 16, 37
BspQI GCTCTTC 1 cut(s) 123
BssMI GATC 1 cut(s) 101
Bst6I CTCTTC 1 cut(s) 123
BstC8I GCNNGC 1 cut(s) 71
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 83
BstFNI CGCG 2 cut(s) 16, 37
BstHHI GCGC 1 cut(s) 39
BstKTI GATC 1 cut(s) 104
BstMAI GTCTC 1 cut(s) 63
BstMBI GATC 1 cut(s) 101
BstMWI GCNNNNNNNGC 2 cut(s) 13, 116
BstUI CGCG 2 cut(s) 16, 37
Bsu15I ATCGAT 1 cut(s) 95
BsuTUI ATCGAT 1 cut(s) 95
BtsCI GGATG 1 cut(s) 83
BtuMI TCGCGA 1 cut(s) 16
Cac8I GCNNGC 1 cut(s) 71
CfoI GCGC 1 cut(s) 39
ClaI ATCGAT 1 cut(s) 95
CseI GACGC 1 cut(s) 21
CviAII CATG 1 cut(s) 134
CviJI RGCY 1 cut(s) 119
CviKI_1 RGCY 1 cut(s) 119
DdeI CTNAG 1 cut(s) 111
DpnI GATC 1 cut(s) 103
DpnII GATC 1 cut(s) 101
Eam1104I CTCTTC 1 cut(s) 123
EarI CTCTTC 1 cut(s) 123
EciI GGCGGA 1 cut(s) 68
FaeI CATG 1 cut(s) 137
FaiI YATR 2 cut(s) 67, 135
FatI CATG 1 cut(s) 133
FokI GGATG 1 cut(s) 70
GlaI GCGC 1 cut(s) 38
GsaI CCCAGC 1 cut(s) 123
HgaI GACGC 1 cut(s) 21
HhaI GCGC 1 cut(s) 39
Hin1II CATG 1 cut(s) 137
Hin6I GCGC 1 cut(s) 37
HinP1I GCGC 1 cut(s) 37
HinfI GANTC 1 cut(s) 56
Hpy188III TCNNGA 1 cut(s) 15
Hpy99I CGWCG 2 cut(s) 25, 37
HpyAV CCTTC 2 cut(s) 51, 109
HpyF10VI GCNNNNNNNGC 2 cut(s) 13, 116
HpyF3I CTNAG 1 cut(s) 111
Hsp92II CATG 1 cut(s) 137
HspAI GCGC 1 cut(s) 37
Kzo9I GATC 1 cut(s) 101
LguI GCTCTTC 1 cut(s) 123
LpnPI CCDG 2 cut(s) 47, 105
MalI GATC 1 cut(s) 103
MboI GATC 1 cut(s) 101
MboII GAAGA 1 cut(s) 140
MlyI GAGTC 1 cut(s) 65
MmeI TCCRAC 1 cut(s) 111
MnlI CCTC 1 cut(s) 87
MvnI CGCG 2 cut(s) 16, 37
MwoI GCNNNNNNNGC 2 cut(s) 13, 116
NdeII GATC 1 cut(s) 101
NlaIII CATG 1 cut(s) 137
NruI TCGCGA 1 cut(s) 16
PciSI GCTCTTC 1 cut(s) 123
PcsI WCGNNNNNNNCGW 2 cut(s) 20, 29
PleI GAGTC 1 cut(s) 64
PpsI GAGTC 1 cut(s) 64
PspFI CCCAGC 1 cut(s) 119
RruI TCGCGA 1 cut(s) 16
SapI GCTCTTC 1 cut(s) 123
Sau3AI GATC 1 cut(s) 101
SchI GAGTC 1 cut(s) 65
SetI ASST 1 cut(s) 79
SgeI CNNG 8 cut(s) 27, 36, 48, 74, 82, 117, 132, 146
SsiI CCGC 1 cut(s) 53
TaqI TCGA 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.