Rroxscaffold_3G00234410

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
20770725 .. 20775218
4494 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00234410.1

Sequence Viewer

Length: 165 bp
ATGGCGGAGCCTCTGGTATGCTCGCTACTTGCGTCATCCAACCCATCGATACGATCAAGTGCTGAGAAGGCTGGGAGTGAAGGGCATGGAGATAAAGAAACCAGAGCAGATCAAAACCGTGGCCTCACTCATAATCCCTGGAGGAGAGAGCACCACCATGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

5.92

Weight (kDa)

6.96

Isoelectric Point (pI)

41.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AjnI CCWGG 1 cut(s) 137
Alw21I GWGCWC 1 cut(s) 153
AoxI GGCC 1 cut(s) 121
Bbv12I GWGCWC 1 cut(s) 153
BccI CCATC 1 cut(s) 52
BciT130I CCWGG 1 cut(s) 139
Bme1390I CCNGG 1 cut(s) 139
BmiI GGNNCC 1 cut(s) 9
BmrFI CCNGG 1 cut(s) 139
BpmI CTGGAG 1 cut(s) 160
Bsa29I ATCGAT 1 cut(s) 47
BsaJI CCNNGG 3 cut(s) 118, 137, 157
BseBI CCWGG 1 cut(s) 139
BseCI ATCGAT 1 cut(s) 47
BseDI CCNNGG 3 cut(s) 118, 137, 157
BseGI GGATG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 54
BseRI GAGGAG 1 cut(s) 157
BseYI CCCAGC 1 cut(s) 71
BshFI GGCC 1 cut(s) 123
BshVI ATCGAT 1 cut(s) 47
BsiHKAI GWGCWC 1 cut(s) 153
BsnI GGCC 1 cut(s) 123
Bsp1286I GDGCHC 1 cut(s) 153
Bsp143I GATC 2 cut(s) 53, 109
Bsp19I CCATGG 1 cut(s) 157
BspACI CCGC 1 cut(s) 5
BspANI GGCC 1 cut(s) 123
BspCNI CTCAG 1 cut(s) 55
BspDI ATCGAT 1 cut(s) 47
BspLI GGNNCC 1 cut(s) 9
BssECI CCNNGG 3 cut(s) 118, 137, 157
BssMI GATC 2 cut(s) 53, 109
BssT1I CCWWGG 1 cut(s) 157
Bst2UI CCWGG 1 cut(s) 139
Bst4CI ACNGT 1 cut(s) 119
BstC8I GCNNGC 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 63
BstDSI CCRYGG 2 cut(s) 118, 157
BstF5I GGATG 1 cut(s) 35
BstKTI GATC 2 cut(s) 56, 112
BstMBI GATC 2 cut(s) 53, 109
BstMWI GCNNNNNNNGC 1 cut(s) 68
BstNI CCWGG 1 cut(s) 139
BstSCI CCNGG 1 cut(s) 137
Bsu15I ATCGAT 1 cut(s) 47
BsuRI GGCC 1 cut(s) 123
BsuTUI ATCGAT 1 cut(s) 47
BtgI CCRYGG 2 cut(s) 118, 157
BtsCI GGATG 1 cut(s) 35
Cac8I GCNNGC 1 cut(s) 23
ClaI ATCGAT 1 cut(s) 47
CseI GACGC 1 cut(s) 21
CviAII CATG 2 cut(s) 86, 158
CviJI RGCY 4 cut(s) 10, 71, 123, 162
CviKI_1 RGCY 4 cut(s) 10, 71, 123, 162
DdeI CTNAG 1 cut(s) 63
DpnI GATC 2 cut(s) 55, 111
DpnII GATC 2 cut(s) 53, 109
EciI GGCGGA 1 cut(s) 20
Eco130I CCWWGG 1 cut(s) 157
EcoRII CCWGG 1 cut(s) 137
EcoT14I CCWWGG 1 cut(s) 157
ErhI CCWWGG 1 cut(s) 157
FaeI CATG 2 cut(s) 89, 161
FaiI YATR 4 cut(s) 19, 87, 132, 159
FatI CATG 2 cut(s) 85, 157
FokI GGATG 1 cut(s) 22
GsaI CCCAGC 1 cut(s) 75
GsuI CTGGAG 1 cut(s) 160
HaeIII GGCC 1 cut(s) 123
HgaI GACGC 1 cut(s) 21
Hin1II CATG 2 cut(s) 89, 161
HpyAV CCTTC 2 cut(s) 61, 74
HpyCH4III ACNGT 1 cut(s) 119
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
HpyF3I CTNAG 1 cut(s) 63
Hsp92II CATG 2 cut(s) 89, 161
Kzo9I GATC 2 cut(s) 53, 109
LmnI GCTCC 1 cut(s) 7
LpnPI CCDG 4 cut(s) 57, 115, 124, 151
MalI GATC 2 cut(s) 55, 111
MboI GATC 2 cut(s) 53, 109
MhlI GDGCHC 1 cut(s) 153
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 3 cut(s) 21, 134, 135
MslI CAYNNNNRTG 1 cut(s) 156
MspR9I CCNGG 1 cut(s) 139
MvaI CCWGG 1 cut(s) 139
MwoI GCNNNNNNNGC 1 cut(s) 68
NcoI CCATGG 1 cut(s) 157
NdeII GATC 2 cut(s) 53, 109
NlaIII CATG 2 cut(s) 89, 161
NlaIV GGNNCC 1 cut(s) 9
PcsI WCGNNNNNNNCGW 1 cut(s) 29
Psp6I CCWGG 1 cut(s) 137
PspFI CCCAGC 1 cut(s) 71
PspGI CCWGG 1 cut(s) 137
PspN4I GGNNCC 1 cut(s) 9
RseI CAYNNNNRTG 1 cut(s) 156
Sau3AI GATC 2 cut(s) 53, 109
ScrFI CCNGG 1 cut(s) 139
SduI GDGCHC 1 cut(s) 153
SmiMI CAYNNNNRTG 1 cut(s) 156
SsiI CCGC 1 cut(s) 5
StyD4I CCNGG 1 cut(s) 137
StyI CCWWGG 1 cut(s) 157
TaaI ACNGT 1 cut(s) 119
TaqI TCGA 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.