RchiOBHm_Chr5g0081661

acyl-activating enzyme 1

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
87611349 .. 87612152
804 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35591

Sequence Viewer

Length: 225 bp
ATGGAGGGTGCAATTAGGTGCTCCACCAACTATGTTCCTCTTTCTCTGATCAGCTTCCTGGAGCGCTCAGCCATAGTCTACAGAGACATACCCTCTATTATGTATGGAGACATCGTCTACACTTGGAGACAGACACTTGAACGATGCACCAGACTTGCTTCTGCTCTTGCCCAACTTGGAATTTCTCGAGGCGATGTGAGTTGGGAAGTGTTGGCTTATCTCTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.4

Weight (kDa)

6.1

Isoelectric Point (pI)

17.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AMP-binding PF00501 21 - 66 4e-06 AMP-binding enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 78, 117
AcsI RAATTY 1 cut(s) 180
AfeI AGCGCT 1 cut(s) 65
AgsI TTSAA 1 cut(s) 140
AjnI CCWGG 1 cut(s) 57
AluBI AGCT 1 cut(s) 54
AluI AGCT 1 cut(s) 54
Alw21I GWGCWC 1 cut(s) 23
Alw26I GTCTC 3 cut(s) 78, 102, 121
Ama87I CYCGRG 1 cut(s) 186
Aor51HI AGCGCT 1 cut(s) 65
ApoI RAATTY 1 cut(s) 180
AspLEI GCGC 1 cut(s) 66
AvaI CYCGRG 1 cut(s) 186
Bbv12I GWGCWC 1 cut(s) 23
BciT130I CCWGG 1 cut(s) 59
BclI TGATCA 1 cut(s) 48
BcoDI GTCTC 3 cut(s) 78, 102, 121
BfmI CTRYAG 1 cut(s) 79
BfoI RGCGCY 1 cut(s) 67
BlpI GCTNAGC 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 59
BmeT110I CYCGRG 1 cut(s) 186
BmrFI CCNGG 1 cut(s) 59
BmsI GCATC 1 cut(s) 134
BpmI CTGGAG 1 cut(s) 80
Bpu1102I GCTNAGC 1 cut(s) 67
BsaXI ACNNNNNCTCC 2 cut(s) 99, 129
BseBI CCWGG 1 cut(s) 59
BseMII CTCAG 1 cut(s) 81
BsiHKAI GWGCWC 1 cut(s) 23
BsiHKCI CYCGRG 1 cut(s) 186
BsmAI GTCTC 3 cut(s) 78, 102, 121
BsoBI CYCGRG 1 cut(s) 186
Bsp1286I GDGCHC 1 cut(s) 23
Bsp143I GATC 1 cut(s) 48
Bsp1720I GCTNAGC 1 cut(s) 67
BspCNI CTCAG 1 cut(s) 80
BssMI GATC 1 cut(s) 48
Bst2UI CCWGG 1 cut(s) 59
BstDEI CTNAG 1 cut(s) 67
BstH2I RGCGCY 1 cut(s) 67
BstHHI GCGC 1 cut(s) 66
BstKTI GATC 1 cut(s) 51
BstMAI GTCTC 3 cut(s) 78, 102, 121
BstMBI GATC 1 cut(s) 48
BstNI CCWGG 1 cut(s) 59
BstSCI CCNGG 1 cut(s) 57
BstSFI CTRYAG 1 cut(s) 79
BtgZI GCGATG 1 cut(s) 207
CfoI GCGC 1 cut(s) 66
CviJI RGCY 3 cut(s) 54, 71, 215
CviKI_1 RGCY 3 cut(s) 54, 71, 215
DdeI CTNAG 1 cut(s) 67
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
Eco47III AGCGCT 1 cut(s) 65
Eco88I CYCGRG 1 cut(s) 186
EcoRII CCWGG 1 cut(s) 57
FaiI YATR 5 cut(s) 33, 74, 89, 101, 105
FbaI TGATCA 1 cut(s) 48
FblI GTMKAC 2 cut(s) 78, 117
GlaI GCGC 1 cut(s) 65
GsuI CTGGAG 1 cut(s) 80
HaeII RGCGCY 1 cut(s) 67
HhaI GCGC 1 cut(s) 66
Hin6I GCGC 1 cut(s) 64
HinP1I GCGC 1 cut(s) 64
Hpy166II GTNNAC 2 cut(s) 79, 118
Hpy188I TCNGA 2 cut(s) 48, 224
Hpy188III TCNNGA 1 cut(s) 186
Hpy8I GTNNAC 2 cut(s) 79, 118
HpyCH4V TGCA 2 cut(s) 11, 147
HpyF3I CTNAG 1 cut(s) 67
HspAI GCGC 1 cut(s) 64
Ksp22I TGATCA 1 cut(s) 48
Kzo9I GATC 1 cut(s) 48
LmnI GCTCC 2 cut(s) 26, 61
LpnPI CCDG 3 cut(s) 44, 71, 163
LweI GCATC 1 cut(s) 134
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MhlI GDGCHC 1 cut(s) 23
MluCI AATT 2 cut(s) 12, 180
MnlI CCTC 3 cut(s) 48, 103, 182
MspR9I CCNGG 1 cut(s) 59
MvaI CCWGG 1 cut(s) 59
NdeII GATC 1 cut(s) 48
PaeR7I CTCGAG 1 cut(s) 186
PflFI GACNNNGTC 1 cut(s) 113
PfoI TCCNGGA 1 cut(s) 57
Psp6I CCWGG 1 cut(s) 57
PspGI CCWGG 1 cut(s) 57
PsyI GACNNNGTC 1 cut(s) 113
Sau3AI GATC 1 cut(s) 48
ScrFI CCNGG 1 cut(s) 59
SduI GDGCHC 1 cut(s) 23
SetI ASST 2 cut(s) 20, 56
SfaNI GCATC 1 cut(s) 134
SfcI CTRYAG 1 cut(s) 79
Sfr274I CTCGAG 1 cut(s) 186
SlaI CTCGAG 1 cut(s) 186
SmlI CTYRAG 1 cut(s) 186
SmoI CTYRAG 1 cut(s) 186
Sse9I AATT 2 cut(s) 12, 180
StyD4I CCNGG 1 cut(s) 57
TaqI TCGA 1 cut(s) 187
TasI AATT 2 cut(s) 12, 180
Tth111I GACNNNGTC 1 cut(s) 113
XapI RAATTY 1 cut(s) 180
XhoI CTCGAG 1 cut(s) 186
XmiI GTMKAC 2 cut(s) 78, 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.