Rmu_sc0022221.1_g000001

acyl-activating enzyme 1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022221.1
Physical Location & Seq
Reverse (-)
1036 .. 2342
1307 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022221.1_g000001.1.cds

Sequence Viewer

Length: 303 bp
atgaaactcgcctcgagaaattccaagttgggcaagagcagaagcaagtctggtgcatcgttcaagtgtctgtctccaagtgtagacgatgtctccatacacaacagagggtgctccgccaactatgttcctctttctccgatcagcttcttggagcgctcagccatagtctacagagacagaccctctgttgtgtatggagacatcgtctacacttggagacagacacttgaacgatgcaccagacttgcttctgctcttgcccaacttggaatttctcgaggcgatgtggtaagaaactga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.04

Weight (kDa)

10.11

Isoelectric Point (pI)

35.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 3 cut(s) 84, 171, 210
AciI CCGC 1 cut(s) 117
AcsI RAATTY 2 cut(s) 19, 273
AfeI AGCGCT 1 cut(s) 158
AgsI TTSAA 2 cut(s) 64, 233
AluBI AGCT 1 cut(s) 147
AluI AGCT 1 cut(s) 147
Alw21I GWGCWC 1 cut(s) 116
Alw26I GTCTC 5 cut(s) 78, 97, 171, 195, 214
Ama87I CYCGRG 2 cut(s) 13, 279
Aor51HI AGCGCT 1 cut(s) 158
ApoI RAATTY 2 cut(s) 19, 273
AspLEI GCGC 1 cut(s) 159
AvaI CYCGRG 2 cut(s) 13, 279
Bbv12I GWGCWC 1 cut(s) 116
BcoDI GTCTC 5 cut(s) 78, 97, 171, 195, 214
BfmI CTRYAG 1 cut(s) 172
BfoI RGCGCY 1 cut(s) 160
BlpI GCTNAGC 1 cut(s) 160
BmeT110I CYCGRG 2 cut(s) 13, 279
BmsI GCATC 2 cut(s) 65, 227
Bpu1102I GCTNAGC 1 cut(s) 160
BsaXI ACNNNNNCTCC 4 cut(s) 77, 107, 192, 222
BseMII CTCAG 1 cut(s) 174
BsiHKAI GWGCWC 1 cut(s) 116
BsiHKCI CYCGRG 2 cut(s) 13, 279
BsmAI GTCTC 5 cut(s) 78, 97, 171, 195, 214
BsoBI CYCGRG 2 cut(s) 13, 279
Bsp1286I GDGCHC 1 cut(s) 116
Bsp143I GATC 1 cut(s) 141
Bsp1720I GCTNAGC 1 cut(s) 160
BspACI CCGC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 173
BssMI GATC 1 cut(s) 141
BstDEI CTNAG 1 cut(s) 160
BstH2I RGCGCY 1 cut(s) 160
BstHHI GCGC 1 cut(s) 159
BstKTI GATC 1 cut(s) 144
BstMAI GTCTC 5 cut(s) 78, 97, 171, 195, 214
BstMBI GATC 1 cut(s) 141
BstSFI CTRYAG 1 cut(s) 172
CfoI GCGC 1 cut(s) 159
CviJI RGCY 2 cut(s) 147, 164
CviKI_1 RGCY 2 cut(s) 147, 164
DdeI CTNAG 1 cut(s) 160
DpnI GATC 1 cut(s) 143
DpnII GATC 1 cut(s) 141
EciI GGCGGA 1 cut(s) 106
Eco47III AGCGCT 1 cut(s) 158
Eco88I CYCGRG 2 cut(s) 13, 279
FaiI YATR 4 cut(s) 98, 126, 167, 198
FblI GTMKAC 3 cut(s) 84, 171, 210
GlaI GCGC 1 cut(s) 158
HaeII RGCGCY 1 cut(s) 160
HhaI GCGC 1 cut(s) 159
Hin6I GCGC 1 cut(s) 157
HinP1I GCGC 1 cut(s) 157
Hpy166II GTNNAC 3 cut(s) 85, 172, 211
Hpy188I TCNGA 1 cut(s) 141
Hpy188III TCNNGA 2 cut(s) 15, 279
Hpy8I GTNNAC 3 cut(s) 85, 172, 211
HpyCH4V TGCA 2 cut(s) 56, 240
HpyF3I CTNAG 1 cut(s) 160
HspAI GCGC 1 cut(s) 157
Kzo9I GATC 1 cut(s) 141
LmnI GCTCC 2 cut(s) 119, 154
LpnPI CCDG 2 cut(s) 36, 256
LweI GCATC 2 cut(s) 65, 227
MalI GATC 1 cut(s) 143
MboI GATC 1 cut(s) 141
MhlI GDGCHC 1 cut(s) 116
MluCI AATT 2 cut(s) 19, 273
MnlI CCTC 5 cut(s) 22, 101, 141, 196, 275
NdeII GATC 1 cut(s) 141
PaeR7I CTCGAG 2 cut(s) 13, 279
PflFI GACNNNGTC 2 cut(s) 89, 206
PsyI GACNNNGTC 2 cut(s) 89, 206
Sau3AI GATC 1 cut(s) 141
SduI GDGCHC 1 cut(s) 116
SetI ASST 1 cut(s) 149
SfaNI GCATC 2 cut(s) 65, 227
SfcI CTRYAG 1 cut(s) 172
Sfr274I CTCGAG 2 cut(s) 13, 279
SlaI CTCGAG 2 cut(s) 13, 279
SmlI CTYRAG 2 cut(s) 13, 279
SmoI CTYRAG 2 cut(s) 13, 279
Sse9I AATT 2 cut(s) 19, 273
SsiI CCGC 1 cut(s) 117
TaqI TCGA 2 cut(s) 14, 280
TasI AATT 2 cut(s) 19, 273
TspDTI ATGAA 1 cut(s) 17
Tth111I GACNNNGTC 2 cut(s) 89, 206
XapI RAATTY 2 cut(s) 19, 273
XhoI CTCGAG 2 cut(s) 13, 279
XmiI GTMKAC 3 cut(s) 84, 171, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.