RchiOBHm_Chr2g0113281

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
25462324 .. 25462870
547 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48663

Sequence Viewer

Length: 126 bp
ATGGGTTTTAATTATAGATGGGTGGAGATTTGGGGATACCTGCGTTCCCTGAAGAAGACTGCATTCTTCAAGAGTGAGATTCAGAGGAGGTTGTTTGTGATGGCAGTACTGATCAATTGTGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

41

Amino Acids

5.03

Weight (kDa)

9.86

Isoelectric Point (pI)

57.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 48
AcuI CTGAAG 1 cut(s) 71
AfaI GTAC 1 cut(s) 108
AgsI TTSAA 1 cut(s) 70
BaeI ACNNNNGTAYC 2 cut(s) 28, 61
BbsI GAAGAC 1 cut(s) 62
BccI CCATC 2 cut(s) 12, 94
BciVI GTATCC 1 cut(s) 29
BclI TGATCA 1 cut(s) 111
BfuAI ACCTGC 1 cut(s) 48
BfuI GTATCC 1 cut(s) 29
BmcAI AGTACT 1 cut(s) 108
BpiI GAAGAC 1 cut(s) 62
BseRI GAGGAG 1 cut(s) 100
BsmI GAATGC 1 cut(s) 62
Bsp143I GATC 1 cut(s) 111
BspMI ACCTGC 1 cut(s) 48
BssMI GATC 1 cut(s) 111
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BstV2I GAAGAC 1 cut(s) 62
BsuI GTATCC 1 cut(s) 29
BveI ACCTGC 1 cut(s) 48
Csp6I GTAC 1 cut(s) 107
CviQI GTAC 1 cut(s) 107
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
Eco57I CTGAAG 1 cut(s) 71
FaiI YATR 1 cut(s) 15
FbaI TGATCA 1 cut(s) 111
HinfI GANTC 1 cut(s) 79
Hpy188I TCNGA 1 cut(s) 84
Hpy188III TCNNGA 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 62
Ksp22I TGATCA 1 cut(s) 111
Kzo9I GATC 1 cut(s) 111
LpnPI CCDG 2 cut(s) 53, 62
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MboII GAAGA 3 cut(s) 58, 64, 67
MfeI CAATTG 1 cut(s) 115
MluCI AATT 2 cut(s) 10, 115
MnlI CCTC 2 cut(s) 78, 81
MseI TTAA 1 cut(s) 9
MunI CAATTG 1 cut(s) 115
Mva1269I GAATGC 1 cut(s) 62
NdeII GATC 1 cut(s) 111
PctI GAATGC 1 cut(s) 62
PfeI GAWTC 1 cut(s) 79
RsaI GTAC 1 cut(s) 108
RsaNI GTAC 1 cut(s) 107
SaqAI TTAA 1 cut(s) 9
Sau3AI GATC 1 cut(s) 111
ScaI AGTACT 1 cut(s) 108
SetI ASST 2 cut(s) 42, 92
SgeI CNNG 3 cut(s) 52, 61, 82
Sse9I AATT 2 cut(s) 10, 115
TasI AATT 2 cut(s) 10, 115
TatI WGTACW 1 cut(s) 106
TfiI GAWTC 1 cut(s) 79
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
ZrmI AGTACT 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.