Rroxscaffold_1G00033120
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
47686161 .. 47691812
5652 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00033120.1

Sequence Viewer

Length: 216 bp
ATGAAACCATTGCCTCTAAAAGCATCACGGGACATCTTGAGGTTGATGCACCATACTTACCGCAGTCAGGGATTTAAGTTGTTTGTAAGGTTCTTTGAAATATATGGAGGAAAACTTTTTGATCTGCTCAATGAGCGCAAAAAGCTTTGCATGAGAGAAGATGGTAAGCAACAAGTTTGTATTGTGGTTTGCAAGAATACAAAGTGTCTGATGTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.47

Weight (kDa)

9.84

Isoelectric Point (pI)

40.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Kinesin PF00225 7 - 65 2.6e-07 Kinesin motor domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 61
AfiI CCNNNNNNNGG 1 cut(s) 67
AgsI TTSAA 1 cut(s) 98
AluBI AGCT 1 cut(s) 145
AluI AGCT 1 cut(s) 145
AspLEI GCGC 1 cut(s) 138
BccI CCATC 1 cut(s) 155
BmsI GCATC 2 cut(s) 32, 36
BpuEI CTTGAG 1 cut(s) 58
Bsc4I CCNNNNNNNGG 1 cut(s) 67
Bse3DI GCAATG 1 cut(s) 8
BseLI CCNNNNNNNGG 1 cut(s) 67
BseMI GCAATG 1 cut(s) 8
BslFI GGGAC 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 67
BsmFI GGGAC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 121
BspACI CCGC 1 cut(s) 61
BsrDI GCAATG 1 cut(s) 8
BssMI GATC 1 cut(s) 121
BstHHI GCGC 1 cut(s) 138
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstMWI GCNNNNNNNGC 2 cut(s) 133, 142
CfoI GCGC 1 cut(s) 138
CviAII CATG 1 cut(s) 151
CviJI RGCY 1 cut(s) 145
CviKI_1 RGCY 1 cut(s) 145
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
FaeI CATG 1 cut(s) 154
FaiI YATR 4 cut(s) 54, 103, 105, 152
FaqI GGGAC 1 cut(s) 44
FatI CATG 1 cut(s) 150
GlaI GCGC 1 cut(s) 137
HhaI GCGC 1 cut(s) 138
Hin1II CATG 1 cut(s) 154
Hin6I GCGC 1 cut(s) 136
HinP1I GCGC 1 cut(s) 136
HindIII AAGCTT 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 210
Hpy188III TCNNGA 1 cut(s) 37
HpyCH4V TGCA 3 cut(s) 49, 150, 192
HpyF10VI GCNNNNNNNGC 2 cut(s) 133, 142
Hsp92II CATG 1 cut(s) 154
HspAI GCGC 1 cut(s) 136
Kzo9I GATC 1 cut(s) 121
LpnPI CCDG 1 cut(s) 53
LweI GCATC 2 cut(s) 32, 36
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MboII GAAGA 1 cut(s) 170
MnlI CCTC 3 cut(s) 24, 33, 101
MseI TTAA 1 cut(s) 75
MwoI GCNNNNNNNGC 2 cut(s) 133, 142
NdeII GATC 1 cut(s) 121
NlaIII CATG 1 cut(s) 154
SaqAI TTAA 1 cut(s) 75
Sau3AI GATC 1 cut(s) 121
SetI ASST 3 cut(s) 44, 92, 147
SfaNI GCATC 2 cut(s) 32, 36
SgeI CNNG 7 cut(s) 39, 41, 49, 80, 163, 185, 205
SmlI CTYRAG 1 cut(s) 37
SmoI CTYRAG 1 cut(s) 37
SsiI CCGC 1 cut(s) 61
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.