RchiOBHm_Chr2g0146981

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
64655305 .. 64655823
519 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51665

Sequence Viewer

Length: 216 bp
ATGCTGGCCATCCTGATCTTCCAGAATTGTCTCTGCTTTGCGCAAGCCTTATACCGTTGGAAAGATACGGATGTTAGCTTTCTAAGGAATTTTACGGAAGTGGATTCGCATTTTTCTGGAGGAAGTTATGATGATTTAAGTGAACCTAGTTCGGGAAGGCAGATTCTGACGGATTTTCAGAATCTGACTTGTGAGGCCCAAGTCCGTTGTTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.1

Weight (kDa)

4.51

Isoelectric Point (pI)

41.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 42
AcoI YGGCCR 1 cut(s) 6
AcsI RAATTY 1 cut(s) 88
AfiI CCNNNNNNNGG 1 cut(s) 152
AluBI AGCT 1 cut(s) 78
AluI AGCT 1 cut(s) 78
Alw26I GTCTC 1 cut(s) 35
AlwNI CAGNNNCTG 2 cut(s) 166, 184
AoxI GGCC 2 cut(s) 6, 195
ApoI RAATTY 1 cut(s) 88
AspLEI GCGC 1 cut(s) 43
AspS9I GGNCC 1 cut(s) 196
BaeI ACNNNNGTAYC 2 cut(s) 57, 90
BalI TGGCCA 1 cut(s) 8
BccI CCATC 1 cut(s) 17
BcoDI GTCTC 1 cut(s) 35
BfaI CTAG 1 cut(s) 147
BmgT120I GGNCC 1 cut(s) 196
BpmI CTGGAG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 1 cut(s) 152
BseGI GGATG 2 cut(s) 9, 76
BseLI CCNNNNNNNGG 1 cut(s) 152
BshFI GGCC 2 cut(s) 8, 197
BslI CCNNNNNNNGG 1 cut(s) 152
BsmAI GTCTC 1 cut(s) 35
BsnI GGCC 2 cut(s) 8, 197
Bsp143I GATC 1 cut(s) 15
BspANI GGCC 2 cut(s) 8, 197
BssMI GATC 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 56
BstC8I GCNNGC 2 cut(s) 6, 45
BstDEI CTNAG 2 cut(s) 83, 213
BstF5I GGATG 2 cut(s) 9, 76
BstHHI GCGC 1 cut(s) 43
BstKTI GATC 1 cut(s) 18
BstMAI GTCTC 1 cut(s) 35
BstMBI GATC 1 cut(s) 15
BsuRI GGCC 2 cut(s) 8, 197
BtsCI GGATG 2 cut(s) 9, 76
Cac8I GCNNGC 2 cut(s) 6, 45
CaiI CAGNNNCTG 2 cut(s) 166, 184
CfoI GCGC 1 cut(s) 43
Cfr13I GGNCC 1 cut(s) 196
CviJI RGCY 4 cut(s) 8, 47, 78, 197
CviKI_1 RGCY 4 cut(s) 8, 47, 78, 197
DdeI CTNAG 2 cut(s) 83, 213
DpnI GATC 1 cut(s) 17
DpnII GATC 1 cut(s) 15
EaeI YGGCCR 1 cut(s) 6
FaiI YATR 2 cut(s) 52, 129
FokI GGATG 1 cut(s) 83
FspBI CTAG 1 cut(s) 147
FspI TGCGCA 1 cut(s) 42
GlaI GCGC 1 cut(s) 42
GsuI CTGGAG 1 cut(s) 138
HaeIII GGCC 2 cut(s) 8, 197
HhaI GCGC 1 cut(s) 43
Hin6I GCGC 1 cut(s) 41
HinP1I GCGC 1 cut(s) 41
HinfI GANTC 3 cut(s) 104, 163, 181
Hpy166II GTNNAC 1 cut(s) 143
Hpy188I TCNGA 3 cut(s) 168, 180, 186
Hpy188III TCNNGA 4 cut(s) 13, 22, 117, 153
Hpy8I GTNNAC 1 cut(s) 143
HpyAV CCTTC 1 cut(s) 150
HpyCH4III ACNGT 1 cut(s) 56
HpyF3I CTNAG 2 cut(s) 83, 213
HspAI GCGC 1 cut(s) 41
Kzo9I GATC 1 cut(s) 15
LpnPI CCDG 3 cut(s) 26, 35, 102
MaeI CTAG 1 cut(s) 147
MalI GATC 1 cut(s) 17
MboI GATC 1 cut(s) 15
MboII GAAGA 1 cut(s) 10
MlsI TGGCCA 1 cut(s) 8
MluCI AATT 2 cut(s) 25, 88
MluNI TGGCCA 1 cut(s) 8
MmeI TCCRAC 1 cut(s) 38
MnlI CCTC 2 cut(s) 113, 187
Mox20I TGGCCA 1 cut(s) 8
MscI TGGCCA 1 cut(s) 8
MseI TTAA 1 cut(s) 137
Msp20I TGGCCA 1 cut(s) 8
NdeII GATC 1 cut(s) 15
NsbI TGCGCA 1 cut(s) 42
PfeI GAWTC 3 cut(s) 104, 163, 181
PspPI GGNCC 1 cut(s) 196
PstNI CAGNNNCTG 2 cut(s) 166, 184
SaqAI TTAA 1 cut(s) 137
Sau3AI GATC 1 cut(s) 15
Sau96I GGNCC 1 cut(s) 196
SetI ASST 2 cut(s) 80, 148
SgeI CNNG 9 cut(s) 17, 25, 34, 56, 129, 159, 165, 201, 212
Sse9I AATT 2 cut(s) 25, 88
SspMI CTAG 1 cut(s) 147
TaaI ACNGT 1 cut(s) 56
TasI AATT 2 cut(s) 25, 88
TfiI GAWTC 3 cut(s) 104, 163, 181
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
TspGWI ACGGA 4 cut(s) 83, 110, 185, 194
XapI RAATTY 1 cut(s) 88
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.