Rh1DG115600

8-hydroxy-dADP phosphatase activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
21155011 .. 21157650
2640 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG115600.1

Sequence Viewer

Length: 870 bp
ATGGACTTATCTGGGTTTTATTCCGAGCAAGCATATGGCTCCAACACATATTCAATGTCCAAAAATAATTCATATTCATGGGATGCTCCTTCATGGCCACAACAAGAACCCTATAATTGCAACATGGGATGGGTAGATCATTCCAACTACTCATGGTCTGAAAATTCATATTATGAAACTGCACAGTGGTCGTATCCCTCTAGCAATGTCCCATTATCCTATCAAGCTCCAATCTATTTGCAAGAAGATCCTACTATAAAGGAGATGGTGGTTGAACTATTGAAGAGATCAGAAAAATTTGATCACGAGGTTGAAAGGCTTAAACATGATCAATCAAAGCTTGAAGAAAGGCAATCCAAGCTTGCACAAGCACTATTGGAAATTGAATTTCATATATCGGAGGTTGCTAATGCTTGGGAGTTAGAGGATGAAAGACATGCTAGTGGAAGAGAAGAAAATTTTGATCATAAGCCCGATGAGGAAGATGACTATTTTGAGCTAAATATTATTGATGATCAAGCTACCGAGAGCACCTATCTTCCTTCTTCTACTAAAGTTCCTATGAAGCTATGTGCTAACAAGCCAAAGAATGAAGAACCTGAATTTAAAGACGTGAGATCTCATACATTGGATGCTCTTGATGAAGTCACCACTGTGGTAGTTGATGCACCAAATTTTCAAGCATCTGTGGAGCACCAAATTTGTGAAGTTTTTCCTTCTTTACCCTTCGAGCTCGTTCTTCCCATTATTCCAGCTCCAAGACTTGAGCTCATATGTGCTCTCACGCCTCCCTCAAATTCTAAGGATGAGTTCCTCCCACAATCACTTCAACCTCCTTGGCCACCTCCTTTGCAATTGATGATGCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

289

Amino Acids

33.38

Weight (kDa)

4.43

Isoelectric Point (pI)

59.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 242
AcoI YGGCCR 2 cut(s) 95, 839
AcsI RAATTY 8 cut(s) 163, 296, 386, 457, 602, 673, 699, 796
AgsI TTSAA 8 cut(s) 54, 275, 283, 314, 344, 386, 680, 830
AjiI CACGTC 1 cut(s) 613
AleI CACNNNNGTG 1 cut(s) 653
AluBI AGCT 9 cut(s) 227, 340, 361, 499, 521, 568, 733, 755, 769
AluI AGCT 9 cut(s) 227, 340, 361, 499, 521, 568, 733, 755, 769
Alw21I GWGCWC 5 cut(s) 533, 696, 735, 771, 781
AlwI GGATC 1 cut(s) 242
AoxI GGCC 2 cut(s) 95, 839
ApoI RAATTY 8 cut(s) 163, 296, 386, 457, 602, 673, 699, 796
Asp700I GAANNNNTTC 1 cut(s) 711
AsuHPI GGTGA 1 cut(s) 640
BalI TGGCCA 2 cut(s) 97, 841
BanII GRGCYC 2 cut(s) 735, 771
BauI CACGAG 1 cut(s) 305
Bbv12I GWGCWC 5 cut(s) 533, 696, 735, 771, 781
BccI CCATC 2 cut(s) 123, 259
BcgI CGANNNNNNTGC 2 cut(s) 171, 205
BciVI GTATCC 1 cut(s) 204
BclI TGATCA 4 cut(s) 301, 328, 463, 514
BfaI CTAG 2 cut(s) 201, 441
BfuI GTATCC 1 cut(s) 204
BglII AGATCT 1 cut(s) 617
BmgBI CACGTC 1 cut(s) 613
BmiI GGNNCC 1 cut(s) 40
BmsI GCATC 5 cut(s) 73, 622, 655, 692, 852
BpuEI CTTGAG 1 cut(s) 785
BsaJI CCNNGG 1 cut(s) 836
Bse3DI GCAATG 1 cut(s) 211
BseDI CCNNGG 1 cut(s) 836
BseGI GGATG 5 cut(s) 88, 134, 433, 637, 811
BseMI GCAATG 1 cut(s) 211
BsgI GTGCAG 1 cut(s) 165
BshFI GGCC 2 cut(s) 97, 841
BsiHKAI GWGCWC 5 cut(s) 533, 696, 735, 771, 781
BslFI GGGAC 1 cut(s) 194
BsmFI GGGAC 1 cut(s) 194
BsnI GGCC 2 cut(s) 97, 841
Bsp1286I GDGCHC 5 cut(s) 533, 696, 735, 771, 781
Bsp143I GATC 8 cut(s) 136, 247, 287, 301, 328, 463, 514, 617
BspANI GGCC 2 cut(s) 97, 841
BspLI GGNNCC 1 cut(s) 40
BspPI GGATC 1 cut(s) 242
BsrDI GCAATG 1 cut(s) 211
BssECI CCNNGG 1 cut(s) 836
BssMI GATC 8 cut(s) 136, 247, 287, 301, 328, 463, 514, 617
BssSI CACGAG 1 cut(s) 305
BssT1I CCWWGG 1 cut(s) 836
Bst2BI CACGAG 1 cut(s) 305
Bst4CI ACNGT 2 cut(s) 186, 655
Bst6I CTCTTC 2 cut(s) 278, 442
BstC8I GCNNGC 2 cut(s) 30, 363
BstDEI CTNAG 1 cut(s) 801
BstF5I GGATG 5 cut(s) 88, 134, 433, 637, 811
BstKTI GATC 8 cut(s) 139, 250, 290, 304, 331, 466, 517, 620
BstMBI GATC 8 cut(s) 136, 247, 287, 301, 328, 463, 514, 617
BstMWI GCNNNNNNNGC 1 cut(s) 358
BstNSI RCATGY 1 cut(s) 440
BstX2I RGATCY 2 cut(s) 247, 617
BstYI RGATCY 2 cut(s) 247, 617
BsuI GTATCC 1 cut(s) 204
BsuRI GGCC 2 cut(s) 97, 841
BtrI CACGTC 1 cut(s) 613
BtsCI GGATG 5 cut(s) 88, 134, 433, 637, 811
BtsIMutI CAGTG 2 cut(s) 191, 651
Cac8I GCNNGC 2 cut(s) 30, 363
CspCI CAANNNNNGTGG 2 cut(s) 831, 866
CviAII CATG 6 cut(s) 78, 93, 124, 153, 326, 437
DdeI CTNAG 1 cut(s) 801
DpnI GATC 8 cut(s) 138, 249, 289, 303, 330, 465, 516, 619
DpnII GATC 8 cut(s) 136, 247, 287, 301, 328, 463, 514, 617
DraI TTTAAA 1 cut(s) 607
EaeI YGGCCR 2 cut(s) 95, 839
Eam1104I CTCTTC 2 cut(s) 278, 442
EarI CTCTTC 2 cut(s) 278, 442
Ecl136II GAGCTC 2 cut(s) 733, 769
Eco130I CCWWGG 1 cut(s) 836
Eco24I GRGCYC 2 cut(s) 735, 771
Eco53kI GAGCTC 2 cut(s) 733, 769
EcoICRI GAGCTC 2 cut(s) 733, 769
EcoT14I CCWWGG 1 cut(s) 836
EcoT38I GRGCYC 2 cut(s) 735, 771
ErhI CCWWGG 1 cut(s) 836
FaeI CATG 6 cut(s) 81, 96, 127, 156, 329, 440
FaqI GGGAC 1 cut(s) 194
FatI CATG 6 cut(s) 77, 92, 123, 152, 325, 436
FauNDI CATATG 2 cut(s) 34, 773
FbaI TGATCA 4 cut(s) 301, 328, 463, 514
FokI GGATG 5 cut(s) 95, 141, 440, 644, 818
FriOI GRGCYC 2 cut(s) 735, 771
FspBI CTAG 2 cut(s) 201, 441
HaeIII GGCC 2 cut(s) 97, 841
Hin1II CATG 6 cut(s) 81, 96, 127, 156, 329, 440
HindIII AAGCTT 2 cut(s) 338, 359
HphI GGTGA 1 cut(s) 640
Hpy188I TCNGA 4 cut(s) 25, 160, 292, 400
Hpy188III TCNNGA 2 cut(s) 305, 638
HpyAV CCTTC 4 cut(s) 99, 552, 726, 736
HpyCH4III ACNGT 2 cut(s) 186, 655
HpyCH4IV ACGT 1 cut(s) 612
HpyCH4V TGCA 6 cut(s) 120, 182, 241, 365, 668, 853
HpyF10VI GCNNNNNNNGC 1 cut(s) 358
HpyF3I CTNAG 1 cut(s) 801
HpySE526I ACGT 1 cut(s) 612
Hsp92II CATG 6 cut(s) 81, 96, 127, 156, 329, 440
Ksp22I TGATCA 4 cut(s) 301, 328, 463, 514
Kzo9I GATC 8 cut(s) 136, 247, 287, 301, 328, 463, 514, 617
LmnI GCTCC 5 cut(s) 44, 91, 232, 691, 760
LpnPI CCDG 2 cut(s) 612, 765
LweI GCATC 5 cut(s) 73, 622, 655, 692, 852
MaeI CTAG 2 cut(s) 201, 441
MaeII ACGT 1 cut(s) 612
MaeIII GTNAC 1 cut(s) 646
MalI GATC 8 cut(s) 138, 249, 289, 303, 330, 465, 516, 619
MboI GATC 8 cut(s) 136, 247, 287, 301, 328, 463, 514, 617
MfeI CAATTG 1 cut(s) 854
MflI RGATCY 2 cut(s) 247, 617
MhlI GDGCHC 5 cut(s) 533, 696, 735, 771, 781
MlsI TGGCCA 2 cut(s) 97, 841
MluNI TGGCCA 2 cut(s) 97, 841
MmeI TCCRAC 2 cut(s) 66, 168
Mox20I TGGCCA 2 cut(s) 97, 841
MroXI GAANNNNTTC 1 cut(s) 711
MscI TGGCCA 2 cut(s) 97, 841
MseI TTAA 2 cut(s) 321, 606
MslI CAYNNNNRTG 3 cut(s) 76, 441, 653
Msp20I TGGCCA 2 cut(s) 97, 841
MunI CAATTG 1 cut(s) 854
MwoI GCNNNNNNNGC 1 cut(s) 358
NdeI CATATG 2 cut(s) 34, 773
NdeII GATC 8 cut(s) 136, 247, 287, 301, 328, 463, 514, 617
NlaIII CATG 6 cut(s) 81, 96, 127, 156, 329, 440
NlaIV GGNNCC 1 cut(s) 40
NmuCI GTSAC 1 cut(s) 646
NspI RCATGY 1 cut(s) 440
OliI CACNNNNGTG 1 cut(s) 653
PdmI GAANNNNTTC 1 cut(s) 711
Psp124BI GAGCTC 2 cut(s) 735, 771
PspN4I GGNNCC 1 cut(s) 40
PsuI RGATCY 2 cut(s) 247, 617
RseI CAYNNNNRTG 3 cut(s) 76, 441, 653
SacI GAGCTC 2 cut(s) 735, 771
SaqAI TTAA 2 cut(s) 321, 606
Sau3AI GATC 8 cut(s) 136, 247, 287, 301, 328, 463, 514, 617
SduI GDGCHC 5 cut(s) 533, 696, 735, 771, 781
SfaNI GCATC 5 cut(s) 73, 622, 655, 692, 852
SmiMI CAYNNNNRTG 3 cut(s) 76, 441, 653
SmlI CTYRAG 1 cut(s) 764
SmoI CTYRAG 1 cut(s) 764
SspI AATATT 1 cut(s) 505
SspMI CTAG 2 cut(s) 201, 441
SstI GAGCTC 2 cut(s) 735, 771
StyI CCWWGG 1 cut(s) 836
TaaI ACNGT 2 cut(s) 186, 655
TaiI ACGT 1 cut(s) 615
TaqI TCGA 1 cut(s) 729
Tru1I TTAA 2 cut(s) 321, 606
Tru9I TTAA 2 cut(s) 321, 606
TscAI CASTG 2 cut(s) 191, 658
TseFI GTSAC 1 cut(s) 646
Tsp45I GTSAC 1 cut(s) 646
TspRI CASTG 2 cut(s) 191, 658
XapI RAATTY 8 cut(s) 163, 296, 386, 457, 602, 673, 699, 796
XceI RCATGY 1 cut(s) 440
XmnI GAANNNNTTC 1 cut(s) 711
XspI CTAG 2 cut(s) 201, 441
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.