RchiOBHm_Chr2g0153051

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
70484997 .. 70486699
1703 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52216

Sequence Viewer

Length: 159 bp
ATGGCTTATTCTTTTTTCCCTTGTGGTTCATTTATGCTCTTTATTCTAGTTTTGTTGCTTGCTGCAGTTACTTTAAAGTCAGTGCAAGAGAACGATAACTATGCTGCAATGAGAGAAAAGCCAAAAGATTTTGCTAGTGAAAGCATAGCAAGAGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.81

Weight (kDa)

6.04

Isoelectric Point (pI)

26.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
ApeKI GCWGC 2 cut(s) 62, 104
BbvI GCAGC 2 cut(s) 49, 91
BcgI CGANNNNNNTGC 2 cut(s) 83, 117
BfaI CTAG 2 cut(s) 47, 135
BfmI CTRYAG 1 cut(s) 63
BisI GCNGC 2 cut(s) 63, 105
BlsI GCNGC 2 cut(s) 64, 106
Bse3DI GCAATG 1 cut(s) 114
BseMI GCAATG 1 cut(s) 114
BseXI GCAGC 2 cut(s) 49, 91
BspMAI CTGCAG 1 cut(s) 67
BsrDI GCAATG 1 cut(s) 114
BstC8I GCNNGC 1 cut(s) 60
BstSFI CTRYAG 1 cut(s) 63
BstV1I GCAGC 2 cut(s) 49, 91
BtsIMutI CAGTG 1 cut(s) 87
Cac8I GCNNGC 1 cut(s) 60
CviJI RGCY 3 cut(s) 5, 121, 155
CviKI_1 RGCY 3 cut(s) 5, 121, 155
DraI TTTAAA 1 cut(s) 75
FaiI YATR 3 cut(s) 35, 102, 146
Fnu4HI GCNGC 2 cut(s) 63, 105
Fsp4HI GCNGC 2 cut(s) 63, 105
FspBI CTAG 2 cut(s) 47, 135
FspEI CC 4 cut(s) 9, 32, 33, 135
GluI GCNGC 2 cut(s) 63, 105
HpyCH4V TGCA 3 cut(s) 65, 85, 107
Lsp1109I GCAGC 2 cut(s) 49, 91
MaeI CTAG 2 cut(s) 47, 135
MaeIII GTNAC 1 cut(s) 67
MseI TTAA 2 cut(s) 74, 157
PkrI GCNGC 2 cut(s) 64, 106
PstI CTGCAG 1 cut(s) 67
SaqAI TTAA 2 cut(s) 74, 157
SatI GCNGC 2 cut(s) 63, 105
SetI ASST 1 cut(s) 157
SfcI CTRYAG 1 cut(s) 63
SgeI CNNG 5 cut(s) 33, 59, 71, 98, 147
SspMI CTAG 2 cut(s) 47, 135
Tru1I TTAA 2 cut(s) 74, 157
Tru9I TTAA 2 cut(s) 74, 157
TscAI CASTG 1 cut(s) 87
TseI GCWGC 2 cut(s) 62, 104
TspDTI ATGAA 1 cut(s) 18
TspRI CASTG 1 cut(s) 87
XspI CTAG 2 cut(s) 47, 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.